First Report of Apple Stem Grooving Virus Infecting Lotus (Nelumbo nucifera) in China

HomePlant DiseaseVol. 103, No. 4First Report of Apple Stem Grooving Virus Infecting Lotus (Nelumbo nucifera) in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Apple Stem Grooving Virus Infecting Lotus (Nelumbo nucifera) in ChinaZ. He, W. Chen, C. Chen, X. Liu, and L. LiZ. Hehttp://orcid.org/0000-0003-2460-1583School of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, Jiangsu Province, P.R. ChinaSearch for more papers by this author, W. ChenSchool of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, Jiangsu Province, P.R. ChinaSearch for more papers by this author, C. ChenSchool of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, Jiangsu Province, P.R. ChinaSearch for more papers by this author, X. LiuSchool of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, Jiangsu Province, P.R. ChinaSearch for more papers by this author, and L. Li†Corresponding author: L. Li; E-mail: E-mail Address: ljli@yzu.edu.cnSchool of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, Jiangsu Province, P.R. ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Z. He W. Chen C. Chen X. Liu L. Li † School of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, Jiangsu Province, P.R. China Published Online:15 Feb 2019https://doi.org/10.1094/PDIS-09-18-1626-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Lotus (Nelumbo nucifera) is a perennial aquatic plant of the family Nelumbonaceae. Lotus root is one of the most important aquatic food and ornamental crops in China, Japan, India, and other regions. In 2015, we found lotus plants with late germination, early dormancy, decline growth, thin stems, and deep colored, spotted, and striped leaves in Jiangsu province of China. These symptoms seriously affected the quantity and quality of lotus. Several viruses including cucumber mosaic virus (CMV) and dasheen mosaic virus have been reported to infect lotus (Ding et al. 2011; Dong et al. 2017). To identify pathogens associated with lotus samples of cultivar Meirenhong that exhibited yellowing and mosaic symptoms during June to September 2015, bulked leaves of six symptomatic and asymptomatic plants were used for construction of small RNA (sRNA) libraries using Illumina Small RNA version 1.5 Sample Prep Kit. They were sequenced in a single lane on a Genome Analyzer IIx, and the output files were processed with Illumina’s CASAVA pipeline (version 1.8). The reads resulting from sRNA sequencing were processed by removing the adaptor and then assembled de novo into larger contigs using Velvet Software 0.7.31 with a k-mer of 17. BLAST search of the contigs against the GenBank virus reference database revealed the presence of 106 contigs with high similarities of 76.9 to 93.1% with the genomic regions of Apple stem grooving virus (ASGV), a member of the genus Capillovirus of the family Betaflexiviridae. CMV, one novel potyvirus, and badnaviruses were also identified (unpublished). To confirm the presence of ASGV in the plants, total RNA was extracted by TaKaRa MiniBEST Plant RNA Extraction Kit (TaKaRa, Dalian, China). First-strand cDNA was prepared by M-MLV reverse transcription (Invitrogen) using ASGV-specific primers. Two pairs of specific primer sets, ASGVF4641 (TTAGGTGAGAGGCTTTACAC)/ASGVR5784 (TGCAAAGAAGAAGGTAAAGCTC) and ASGVF4791 (CTATCGTCAACGTCAACC)/ASGVR5609 (TTCAATTCTAGCCGAGAG), were designed according to the sequences of contigs obtained in this study and used in nested reverse transcription polymerase chain reaction (RT-PCR), which amplified a 834-bp DNA fragment of the ASGV genome from six lotus plants. A single 834-bp DNA amplicon was randomly selected, purified by TIANgel Midi Purification Kit (Tiangen, Beijing, China), and cloned into the pMD19-T vector (TaKaRa). Three clones were sequenced (Genewiz, Suzhou, China), and analysis of the consensus sequence (GenBank accession no. MH507516) revealed the highest nucleotide sequence identity of 83% with a Japanese ASGV isolate (GenBank accession no. D14995) (Yoshikawa et al. 1992) in the movement protein gene. To investigate the occurrence and distribution of ASGV infection, 43 lotus samples (23 with mosaic and yellowing symptoms and 20 without any symptoms) were collected in different regions of the Jiangsu province and tested by the nested RT-PCR and double-antibody sandwich ELISA using an ASGV kit (Qiaodu, Shanghai). Both assays detected the virus in 27 of the 43 plants, indicating the ASGV infection is common in lotus. Among these 27 positive samples, 16 samples had mosaic or yellowing symptoms. To our knowledge, this is the first report of ASGV in lotus in China. This finding suggests that use of virus-free lotus seedlings will benefit the production of lotus in China.References:Ding, Z., et al. 2011. Hubei Agric. Sci. 50:3078. Google ScholarDong, T., et al. 2017. J. Changjiang Veg. 18:144. Google ScholarYoshikawa, N., et al. 1992. Virology 191:98. https://doi.org/10.1016/0042-6822(92)90170-T Crossref, ISI, Google ScholarFunding: This work was supported by the National Natural Science Foundation of China (no. 31601604), the China Agriculture Research System (CARS-24), and the Natural Science Foundation of the Jiangsu Higher Education Institutions of China (no. 16KJB210015).DetailsFiguresLiterature CitedRelated Vol. 103, No. 4 April 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionGray mold on kiwifruit leaves caused by Botrytis cinerea (courtesy Guoshu Gong and Qinjun Tao); sunflower rust on bracts (courtesy Sam Markell); cucumber plant with mosaic symptoms caused by papaya ringspot virus (courtesy Roger Jones). Metrics Article History Issue Date: 10 Apr 2019Published: 15 Feb 2019First Look: 19 Nov 2018Accepted: 12 Nov 2018 Pages: 782-782 Information© 2019 The American Phytopathological SocietyFundingNational Natural Science Foundation of ChinaGrant/Award Number: 31601604China Agriculture Research SystemGrant/Award Number: CARS-24Natural Science Foundation of the Jiangsu Higher Education Institutions of ChinaGrant/Award Number: 16KJB210015Cited byApple stem grooving virus is associated with leaf yellow mottle mosaic disease on Citrus grandis cv. Huangjinmiyou in ChinaJournal of Integrative Agriculture, Vol. 21, No. 7Cucumber mosaic virus (cucumber mosaic)CABI Compendium, Vol. CABI CompendiumApple stem grooving virusCABI Compendium, Vol. CABI CompendiumFirst Report of Cnidium officinale as a Natural Host Plant of Apple Stem Grooving Virus in South KoreaBong Nam Chung, Sun-Jung Kwon, Ju-Yeon Yoon, and In-Sook Cho13 January 2022 | Plant Disease, Vol. 106, No. 1Gynura japonica: A New Host of Apple Stem Grooving Virus and Chrysanthemum Virus B in ChinaYuchao Lai, Xinyang Wu, Lanqing Lv, Jiajia Weng, Kelei Han, Ziqiang Chen, Jianping Chen, Fei Yan, and Hongying Zheng11 November 2021 | Plant Disease, Vol. 105, No. 11Antiserum Preparation of Recombinant Sweet Potato Latent Virus-Lotus (SPLV-Lotus) Coat Protein and Application for Virus-Infected Lotus Plant DetectionThe Plant Pathology Journal, Vol. 36, No. 6Development of a reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay for the rapid detection of sweet potato latent virus-lotus in lotus plants12 May 2020 | Australasian Plant Pathology, Vol. 49, No. 4Genomic and biological characterization of a novel strain of sweet potato latent virus isolated from lotus (Nelumbo nucifera Gaertn.)8 June 2019 | Journal of Plant Pathology, Vol. 101, No. 4