Characterization of fungal mycobiome in bladder cancer.

542 Background: Bacterial dysbiosis accompanies carcinogenesis in malignancies such as colon, breast and pancreatic cancer. However, the role of fungal mycobiome has not been evaluated in bladder cancer. With the sexual dimorphism that exists within bladder cancer (Bca) prevalence and survival, our study aims to characterize fungal mycobiome composition in Bca. Methods: This is a single site, non-randomized, prospective study of patients with the diagnosis of muscle invasive bladder cancer (MIBC) undergoing cystectomy from September 2020 to May 2021. Stool samples were collected during surgery using aseptic technique. We utilized the ITS1 region from DNA sample extracts, which was amplified in triplicate using primers with high specificity for ascomycete fungi (fluorescently-labeled forward primer ITS1F (CTTGGTCATTTAGAGGAAGTAA) and unlabeled reverse primer ITS2 (GCTGCGTTCTTCATCGATGC). Fungal PCR products were separated on the SCE 9610 capillary DNA sequencer (Spectrumedix LLC, State College, PA) using GenoSpectrum software to convert fluorescent output into electropherograms. Hierarchical clustering by Bray-Curtis distance was performed using hclust2. Mean normalized abundance for each amplicon was calculated from the three PCR replicates of each sample, excluding means below 1%. Results: A total of 29 patients (17 males and 12 females) were enrolled. The median (IQR) age was 74 yo (63-77), males, and 68.5 yo (58-78), females. Per figure 1, Saccharomycecales dominated the fungal community at order level with mean relative abundance of 36.35% females, and 21.20%, males. (Figure 1D) Tremellales was the second most notable order, composing 8.22% and 5.13% of male and female samples. There were no differences seen in alpha and beta diversity (Figure 1C) (Figure 1A, C), notable differences were seen across orders. The greatest difference between sexes in LDA( M:F) were noted in Saccharomycecales (log change -4.686, p=0.001/ p adj = 0.01), Tremellales (log change 5.119, p=0.001/p adj = 0.01), and Sporidiobolales (log change 4.839, p=0.001 p adj = 0.03). (Figure 1B). Female bladder cancer patients demonstrating an increase abundance of Saccharomycecale. When assessing differences in fungal composition in patients with history of neoadjuvant therapy( NAC) (receipt vs none), patients with history of NAC exhibited a 3.48 increase in Saccharomycecale (p adj = 0.015 ), 4.81 increase Tremalles (p adj = 0.009) and 4.37 increase Pleosporales(p adj = 0.009) . Conclusions: Mycobiome is an integral part of gut microbiota, with fungal elements relatively poorly studied. Nevertheless, the association between fungal dysbiosis and carcinogenesis across multiple cancers exists. Our study is the first to characterize fungal profile in bladder cancer patients, stratified by sex and receipt of NAC, with results highlighting key fungal players: Saccharomycecale, Tremallales, Pleosoporales.