β‐Lactolin improves mitochondrial function in Aβ‐treated mouse hippocampal neuronal cell line and a human iPSC‐derived neuronal cell model of Alzheimer's disease

The FASEB JournalVolume 36, Issue 4 e22277 RESEARCH ARTICLEOpen Access β-Lactolin improves mitochondrial function in Aβ-treated mouse hippocampal neuronal cell line and a human iPSC-derived neuronal cell model of Alzheimer's disease Tatsuhiro Ayabe, Corresponding Author Tatsuhiro Ayabe [email protected] orcid.org/0000-0002-5023-4986 Kirin Central Research Institute, Kirin Holdings Company Limited, Fujisawa, Japan Correspondence Tatsuhiro Ayabe, Kirin Central Research Institute, Kirin Holdings Company Limited, 26-1, Muraoka-Higashi 2-chome, Fujisawa-shi, Kanagawa 251-8555, Japan. Email: [email protected]Search for more papers by this authorChika Takahashi, Chika Takahashi Kirin Central Research Institute, Kirin Holdings Company Limited, Fujisawa, JapanSearch for more papers by this authorRena Ohya, Rena Ohya Kirin Central Research Institute, Kirin Holdings Company Limited, Fujisawa, JapanSearch for more papers by this authorYasuhisa Ano, Yasuhisa Ano Kirin Central Research Institute, Kirin Holdings Company Limited, Fujisawa, JapanSearch for more papers by this author Tatsuhiro Ayabe, Corresponding Author Tatsuhiro Ayabe [email protected] orcid.org/0000-0002-5023-4986 Kirin Central Research Institute, Kirin Holdings Company Limited, Fujisawa, Japan Correspondence Tatsuhiro Ayabe, Kirin Central Research Institute, Kirin Holdings Company Limited, 26-1, Muraoka-Higashi 2-chome, Fujisawa-shi, Kanagawa 251-8555, Japan. Email: [email protected]Search for more papers by this authorChika Takahashi, Chika Takahashi Kirin Central Research Institute, Kirin Holdings Company Limited, Fujisawa, JapanSearch for more papers by this authorRena Ohya, Rena Ohya Kirin Central Research Institute, Kirin Holdings Company Limited, Fujisawa, JapanSearch for more papers by this authorYasuhisa Ano, Yasuhisa Ano Kirin Central Research Institute, Kirin Holdings Company Limited, Fujisawa, JapanSearch for more papers by this author First published: 23 March 2022 https://doi.org/10.1096/fj.202101366RRAboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat Abstract Mitochondrial dysfunctions are a key hallmark of Alzheimer's disease (AD). β-Lactolin, a whey-derived glycine–threonine–tryptophan–tyrosine tetrapeptide, has been previously reported to prevent AD-like pathologies in an AD mouse model via regulation of microglial functions. However, the direct effect of β-lactolin on neuronal cells and neuronal mitochondrial functions remains unknown. Here, we investigated the effects of β-lactolin on mitochondrial functions in amyloid β (Aβ)-treated mouse hippocampal neuronal HT22 cells and human induced-pluripotent cell (hiPSC)-derived AD model neurons. Adding β-lactolin to Aβ-treated HT22 cells increased both the oxygen consumption rate and cellular ATP concentrations, suggesting that β-lactolin improves mitochondrial respiration and energy production. Using high content image analysis, we found that β-lactolin improved mitochondrial fragmentation, membrane potential, and oxidative stress in Aβ-treated cells, eventually preventing neuronal cell death. From a mechanistic perspective, we found that β-lactolin increased gene expression of mitofusin-2, which contributes to mitochondrial fusion events. Finally, we showed that β-lactolin improves both mitochondrial morphologies and membrane potentials in hiPSC-derived AD model neurons. Taken together, β-lactolin improved mitochondrial functions AD-related neuronal cell models and prevented neuronal cell death. The dual function of β-lactolin on both neuron and microglia marks an advantage in maintaining neuronal health. Abbreviations AD Alzheimer's disease ATP adenosine triphosphate Aβ amyloid β CBF cerebral blood flow DMSO dimethyl sulfoxide Drp1 dynamin-related protein 1 Fis1 mitochondrial fission 1 hiPSC human induced pluripotent cell MAO-B monoamine oxidase B Mfn1 mitofusin 1 Mfn2 mitofusin 2 MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide OCR oxygen consumption rate Opa1 optic atrophy type 1 OXPHOS oxidative phosphorylation Psen1 Presenilin 1 ROS reactive oxygen species 1 INTRODUCTION Due to an increasingly aging population, dementia and age-related cognitive decline are rapidly becoming major public health issues. Alzheimer's disease (AD) is the most common type of dementia and is characterized by extracellular amyloid β (Aβ) deposits and tau protein-induced neurofibrillary tangles.1, 2 Recent pathological and immunological studies have shown that neuroinflammation induced by activated microglia is another major hallmark of AD.3, 4 In addition, increasing evidence shows that mitochondrial dysfunctions play critical roles in AD pathologies.5, 6 Together these phenomena lead to progressive neuronal loss and cognitive impairment. Mitochondria are an intracellular organelle with crucial roles in cell survival. The most well-known function of mitochondria is energy metabolism, and mitochondria produce adenosine triphosphate (ATP) via the oxidative phosphorylation (OXPHOS) pathway. Mitochondria are also, among other functions, responsible for the generation and removal of reactive oxygen species (ROS), apoptotic signal transduction, and Ca2+ ion storage.7 Mitochondria are highly dynamic organelles, and they continuously undergo fission, fusion, transportation, and degradation events regulated by various proteins.8, 9 In particular, mitochondrial fission 1 (Fis1) and dynamin-related protein 1(Drp1) are involved in the fission process, while mitofusin (Mfn) 1 and 2, as well as optic atrophy type 1 (Opa1) are implicated in the fusion process.9, 10 The breakdown of mitochondrial dynamics induces an increase in ROS, a decrease in mitochondrial membrane potential, respiratory dysfunction, and eventually apoptosis.11 Although mechanisms underlying mitochondrial dysfunctions in AD are not fully understood, growing evidence suggests that Aβ may contribute to mitochondrial dysfunction. Previous work has shown that Aβ deposition is associated with the breakdown of OXPHOS, reduced energy metabolism, and defective mitochondrial membranes in human AD brains.12-14 Studies using an Aβ-based transgenic AD mouse model also showed mitochondrial dysfunction in the organism.15, 16 Recent in vitro studies using the transgenic AD model or Aβ-treated neuronal cells have exhibited phenotypes including diminished mitochondrial respiration, mitochondrial fragmentation, excess mitochondrial ROS production, and neuronal cell death.17, 18 Aβ is thought to induce an imbalance in mitochondrial dynamics by altering gene expression of fission- and fusion-related genes, which in turn leads to mitochondrial dysfunction.19, 20 Furthermore, mitochondrial dysfunction is often observed in early-stage AD,17, 21 suggesting the causative roles of mitochondrial dysfunctions induced by Aβ. Based on this collective evidence, Aβ-induced mitochondrial dysfunction is considered a potential target for the treatment and prevention of AD.22 Although some progress has been made in recent years, a definitive treatment for AD has not been established. Growing attention has been paid to preventive strategies involving lifestyle factors, such as dietary habits. For example, several epidemiological studies have shown that the daily intake of dairy products is related to a lower dementia risk.23, 24 The effects of specific fermented dairy products were investigated, and treatment of dairy products fermented with Penicillium (P.) candidum (e.g., Camambert cheese) prevented Aβ deposition and neuroinflammation in AD model 5 × FAD mice.25 Bioactive molecules responsible for this effect were screened, and β-lactoglobulin-derived glycine–threonine–tryptophan–tyrosine tetrapeptide, designated as β-lactolin, was identified.26 Dietary supplementation of β-lactolin suppressed neuroinflammation, activation, and infiltration of microglia, Aβ deposition, and improved episodic memory impairment in 5 × FAD mice.27 These observations suggested that β-lactolin regulates the function of microglia to suppress neuroinflammation and promote Aβ depletion, which may contribute to the AD-preventive effects. However, direct effects of β-lactolin on neuronal mitochondrial function have not been investigated. In the present study, we sought to understand the effects of β-lactolin on mitochondrial functions and associated neuronal cell health using Aβ-treated mouse hippocampus-derived neuronal HT22 cell line. Aβ-treated HT22 neuronal cells have been utilized as one of AD model neurons to screening out functional molecules.18, 28 We found that β-lactolin improved respiratory functions, as measured by the oxygen consumption rate (OCR) and associated intracellular ATP concentrations. We further assessed the effects of β-lactolin using high content image analysis and found that β-lactolin improved mitochondrial morphologies, membrane potential, and oxidative stress in Aβ-treated cells. Finally, we used human induced-pluripotent cell (hiPSC)-derived AD model neuronal cells to get insight into the function of β-lactolin on human neuronal cell model. We conclude that β-lactolin improves mitochondrial functions in Aβ-treated HT22 cell line and hiPSC-derived neuronal cell model of AD. 2 MATERIALS AND METHODS Materials and drug preparation β-Lactolin (glycine–threonine–tryptophan–tyrosine peptide; purity: 98%) was purchased from Bachem (Bubendorf, Switzerland). Amyloid β1-42 was purchased from Peptide Institute, Inc. (Ibaraki, Japan). Dimethyl sulfoxide (DMSO) was purchased from FUJIFILM Wako Pure Chemical (Osaka, Japan). Both β-lactolin and Aβ were first dissolved in DMSO, and then diluted with phosphate buffered saline (PBS) to meet each experimental condition. Final concentration of DMSO was less than 0.1%. Cell culture Mouse hippocampal neuronal cells HT22 were purchased from Merck Millipore (Darmstadt, Germany). HT22 cells were maintained in Dulbecco's Modified Eagle Medium (DMEM; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Biological Industries, Kibbutz Beit-Haemek, Israel) and 1% penicillin-streptomycin (Thermo Fisher Scientific). Cells were passaged 2 to 3 times a week, upon reaching 80%–90% confluency and were used for experiments between passages 10 and 20. Human iPSC-derived neuronal cells carrying the mutant (P117L) PSEN1 gene (RperoNeuro AD mutation) or its WT control (ReproNeuro) were purchased from ReproCELL Inc. (Yokohama, Japan). Cells were plated on 96-well plates specialized for high content analysis (Cell Carrier Ultra 96; Perkin Elmer) using specialized medium (ReproNeuro Medium; ReproCELL), following the manufacturer's protocol. Cells were incubated under 37°C, 5% CO2 conditions for 14 days, and media was changed on days 1, 3, and 7 after seeding. OCR measurement OCR was measured using an extracellular flux analyzer (XFe 24; Agilent Technologies Inc., Santa Clara, CA, USA) and a mitostress kit (Agilent Technologies Inc.), following the manufacturers' protocols. Briefly, HT22 neuronal cells were seeded at a density of 4.0 × 103 cells/well on the XFe24 cell culture plate (Agilent Technologies Inc.) and incubated for 24 h under 37°C, 5% CO2 conditions. Cells were treated with 10 nM β-lactolin for 1 h, and then 5 μM Aβ was added for the next 23 h. Culture medium was changed to XF base medium containing 10 mM glucose, 1 mM pyruvate, and 2 mM glutamate (all from Agilent Technologies Inc.) and incubated for 1 h under 37°C. Baseline OCR was measured, and then 1 μM oligomycin, 1 μM FCCP, and 0.5 μM rotenone/antimycin A, contained in the mitostress kit, were sequentially added into each well. OCR was measured in triplicate at each stage. After OCR measurement, the cells were collected and the protein level was quantified by bicinchoninic acid assay (Thermo Fisher Scientific), and the data were normalized to protein levels. ATP measurements HT22 cells were seeded onto 96 well plates (4.0 × 103 cells/well) and incubated for 24 h. Cells were treated with β-lactolin (1, 10, 100 nM) or PBS and incubated for 1 h. Then, either 5 μM Aβ or PBS was added for the next 23 h. Intracellular ATP concentrations were measured using a Luminescent ATP Detection Assay Kit (Abcam, Camridge, MA, USA), following the manufacturers protocol. After ATP measurement, the sample protein level was quantified by bicinchoninic acid assay, and the data were normalized to protein levels. Mitochondrial morphology analysis Mitochondrial morphology was evaluated using MitoTracker Green FM (Thermo Fisher Scientific) in HT22 and hiPSC-derived neuronal cells. HT22 cells were seeded onto a 96 well cell carrier plate at a density of 1.0 × 104 cells/well. Cells were treated with β-lactolin (1, 10, 100 nM) or PBS for 1 h and then treated with Aβ (1 μM) or PBS for the next 23 h. WT and AD model hiPSC-derived neurons were treated with β-lactolin (1, 10, 100 nM) or PBS at the same time the media was changed and cultured for 14 days. Culture medium was removed, and cells were stained with 5 μM MitoTracker Green FM and 0.2 μg/ml Hoechst 33342 (Dojindo Laboratories, Kumamoto, Japan) dissolved in Hank's balanced salt solution (HBSS; Thermo Fisher Scientific) for 30 min under 37°C, 5% CO2 conditions. The staining solution was removed, and cells were washed one time with HBSS. Cells were imaged using a high content confocal analysis system (Operetta CLS; Perkin Elmer). Images were analyzed with Harmony software (Pernkin Elmer). For mitochondrial morphology analysis, each cellular region was determined based on the nucleus region stained with Hoechst. MitoTracker Green FM images were processed by applying a sliding parabola function, and the each mitochondrial length or area in the field of view was calculated by the morphology analysis function. Each mitochondria contained in the cellular region was evaluated. Nine fields were analyzed for each well, and at least 100 cells were analyzed per well. Finally, mean mitochondrial area and length were calculated and handled as one data sample. All cells were seeded on the same plate at the same time, from the same batch of the cells. In the experiment with hiPSC-derived neurons, mitochondria were assigned by their length into one of three categories; elongated (>3 μm), intermediate (1–3 μm), and fragmented (<1 μm), and cell population in each category was calculated. Mitochondrial membrane potential evaluation To evaluate mitochondrial membrane potential, HT22 and hiPSC-derived neuronal cells were stained with JC-1 dye (Dojindo Laboratories). JC-1 dye accumulates in mitochondrial membranes and exhibits green fluorescence in its monomer state (Ex/Em = 514/529) at low membrane potentials. At high membrane potentials, JC-1 conjugates into a polymer and exhibits red fluorescence (Ex/Em = 514/590). Both HT22 and hiPSC-derived neuronal cells were cultured and treated with β-lactolin as described in the above experiments. Culture medium was removed, and cells were stained with 4 μM JC-1 and 0.2 μg/ml Hoechst 33342 for 30 min under 37°C, 5% CO2 conditions. Cells were washed one time with HBSS. The intensities of red and green fluorescence were measured with Operetta CLS and Harmony software, and the red/green ratio was calculated as an indicator of mitochondrial membrane potential (Δψm). Similar to morphological analysis, nine fields were analyzed for each well, and at least 100 cells were analyzed per well. All cells were seeded on the same plate at the same time, from the same batch of the cells. Mean mitochondrial intensity and ratio were calculated and handled as one data sample. Mitochondrial ROS analysis Mitochondria-specific ROS were evaluated using MitoSOX Red (Thermo Fischer Scientific). HT22 cells were seeded onto a 96-well cell carrier plate (1.0 × 104 cells/well) and treated with β-lactolin (1, 100 nM) or PBS for 1 h before adding Aβ (1 μM) or PBS for the next 23 h. The culture medium was removed, and cells were stained with 1 μM MitoSOX Red, 5 μM MitoTracker Green FM, and 0.2 μg/ml Hoechst 33342 dissolved in HBSS for 30 min under 37°C, 5% CO2 conditions. The cells were washed one time with HBSS and analyzed with Operetta CLS and Harmony. The mitochondrial ROS was evaluated by measuring the ratio of MitoSOX Red intensity to MitoTracker Green FM intensity. The population of cells with higher mitochondrial ROS was calculated. Similar to above, nine fields were analyzed for each well, and at least 100 cells were analyzed per well. All cells were seeded on the same plate at the same time, from the same batch of the cells. Mean mitochondrial intensity and ratio were calculated and handled as one data sample. Intracellular reactive oxygen species (ROS) analysis Intracellular ROS were evaluated using CM-H2DCFDA dye (Thermo Fischer Scientific). HT22 cells were seeded onto a 96-well cell carrier plate (1.0 × 104 cells/well) and treated with β-lactolin (1, 10 nM) or PBS for 1 h before adding Aβ (1 μM) or PBS for the next 23 h. The culture medium was removed, and cells were stained with 1 μM CM-H2DCFDA and 0.2 μg/ml Hoechst 33342 dissolved in HBSS for 30 min under 37°C, 5% CO2 conditions. The cells were washed one time with HBSS and analyzed with Operetta CLS and Harmony. The intracellular ROS was evaluated by measuring the intensity of CM-H2DCFDA. Cell viability measurements For cell viability measurements, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assays and calcein-acetoxymethyl (calcein-AM) assays were performed. In both experiments, HT22 cells were seeded onto a 96-well plate (4.0 × 103 cells/well) and incubated for 24 h. Cells were treated with β-lactolin (1, 10, 100 nM) or PBS and incubated for 1 h, and then treated with Aβ (1 μM) or PBS for the next 23 h. In MTT assays, the culture medium was removed, and phenol red-free DMEM (Thermo Fishcer Scientific) containing 2.5 mg/ml MTT (Dojindo Laboratories) was added. Cells were incubated for 2 h under 37°C, 5% CO2 conditions and washed with PBS. Cells were lysed using isopropanol (Fujifilm Wako Pure Chemical, Osaka, Japan), and the 540 nm absorbance was measured. The cell viability rate was calculated as follows: [(As − Ab)/(Ac − Ab)] × 100 (As, absorbance of samples; Ac, absorbance of controls; Ab, absorbance of blank). In calcein-AM assays, the culture medium was removed, and phenol red-free DMEM containing 1 M calcein-AM (Thermo Fishcer Scientific) was added. Cells were incubated for 1 h under 37°C, 5% CO2 conditions and washed three times with PBS. Fluorescence was measured (Ex/Em = 485 nm/530 nm) on a fluorescence plate reader (SpectraMax; Molecular Devices, Sunnyvale, CA). The cell viability rate was calculated as follows: [(MFIs − MFIb)/(MFIc − MFIb)] × 100 (MFIs, mean fluorescence intensity of samples; MFIc, mean fluorescence intensity of controls; MFIb, mean fluorescence intensity of blank). Quantitative reverse transcription polymerase chain reaction (RT-PCR) Quantitative RT-PCR was used to measure the expression levels of mRNA. HT22 cells were seeded onto a six-well plate (2.0 × 105 cells/well) and incubated overnight. Cells were treated with β-lactolin (1, 10, 100 nM) or PBS and incubated for 24 h before adding Aβ (10 μM) or PBS for the last 6 h. Total RNA was purified using an RNeasy Mini Kit (QIAGEN, Hilden, Germany) then reverse-transcribed (2.5 μg) using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). SYBR Green Real-Time PCR Technology (Takara Bio Inc., Shiga, Japan) was used to quantify relative RNA levels. Then, data were normalized for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) values. Table 1 describes the primers that were used for PCR. TABLE 1. List of primers used for PCR analysis Gene Forward primer sequence (5′−3′) Reverse primer sequence (5′−3′) Mfn1 GCAGACAGCACATGGAGAGA GATCCGATTCCGAGCTTCCG Mfn2 TGCACCGCCATATAGAGGAAG TCTGCAGTGAACTGGCAATG Opa1 ACCTTGCCAGTTTAGCTCCC TTGGGACCTGCAGTGAAGAA Drp1 ATGCCAGCAAGTCCACAGAA TGTTCTCGGGCAGACAGTTT Fis1 CAAAGAGGAACAGCGGGACT ACAGCCCTCGCACATACTTT Gapdh TCTGCCGATGCCCCCATGTTTG TGGGTGGCAGTGATGGCATGGA Immunocytochemistry Human iPSC-derived AD model neuronal cells and its WT control were plated on 96-well plates as described in the main section. Cells were incubated under 37°C, 5% CO2 conditions for 14 days, and media was changed on days 1, 3, 7, and 13 after seeding. At day 14, the cells were fixed with ice-cold methanol (FUJIFILM Wako Pure Chemical). Anti-NeuN mouse monoclonal antibody and anti-βIII-tubulin rabbit polyclonal antibody (Abcam) were used as primary antibodies. Alexa Flour 647 anti-mouse immunoglobulin G and Alexa Flour 488 anti-rabbit immunoglobulin G (Abcam) were used as secondary antibodies. The cells were counterstained with 4,6-diamidino-2-phenylindole (DAPI; Dojindo Laboratories). Images were captured with Operetta CLS (Perkin-Elmer). Extracellular Aβ measurement Human iPSC-derived AD model neuronal cells and its WT control were plated on 96-well plates as described in the main section. Cells were incubated under 37°C, 5% CO2 conditions for 14 days, and media was changed on days 1, 3, 7, and 13 after seeding. Samples were added at the same time of medium change. Twenty-four hours after the last medium change, medium were collected and the levels of Aβ40 and Aβ42 were measured with Human β Amyloid(1–40) ELISA Kit Wako II and Human β Amyloid(1–42) ELISA Kit Wako (Fujifilm Wako Pure Chemical, Osaka, Japan), respectively. The ratio of Aβ42 to Aβ40 was also calculated. Statistical analysis All values are expressed as mean ± SEM. In multiple comparisons, the data were analyzed by one-way analysis of variance followed by Tukey–Kramer's test. p < .05 was considered a statistically significant difference. All analysis was performed using Ekuseru–Toukei Ver. 7.0 software (Esumi, Tokyo, Japan). 3 RESULTS β-Lactolin improves mitochondrial respiration in Aβ-treated mouse neuronal cell line To establish an Aβ-induced mitochondrial dysfunction model, mouse hippocampus-derived neuronal HT22 cells were treated with Aβ, and the OCR was measured as an indicator of mitochondrial respiratory function. Treatment with Aβ (5 μM) significantly decreased the OCR relative to the basal respiration rate and ATP turnover, indicating that mitochondrial dysfunction was induced by Aβ-treatment (Figure S1). Next, we treated Aβ-treated cells with β-lactolin (10 nM) and measured the change in OCR with a mitostress test (Figure 1A). The OCR related to each mitochondrial function was calculated, and we determined that the treatment of Aβ significantly reduced OCR relative to basal respiration (F[2,39] = 7.161, p = .002; Figure 1B), ATP turnover (F[2,39] = 4.686, p = .015; Figure 1C), and maximal respiration (F[2,39] = 7.242, p = .002; Figure 1D). β-Lactolin treatment tended to increase basal respiration and ATP turnover. Together these results show that treatment with β-lactolin may improve mitochondrial respiratory function in Aβ-treated neuronal cells. FIGURE 1Open in figure viewer The effect of β-lactolin on the oxygen consumption rate in Aβ-treated HT22 neuronal cells. (A) Oxygen consumption rate (OCR) of HT22 cells treated with β-lactolin (10 nM) and Aβ (5 μM) was measured using a Seahorse extracellular flux analyzer. HT22 cells were treated with β-lactolin for 1 h and then Aβ was added for the next 23 h. Oligomycin, FCCP, and rotenone/antimycin A were serially added, and the OCR was continuously measured. Cell respiratory states were divided into four stages: stage I (0–18 min), stage II (27–44 min), stage III (52–69 min), and stage IV (78–95 min). After the measurement, protein levels in each well were evaluated by a bicinchoninic acid assay, and OCR was corrected to each protein level. (B–D) OCR relative to basal respiration (stage I–stage IV), ATP turnover (stage I–stage II), and maximal respiration (stage III–stage IV) were calculated. Data are presented as means ± SEM (n = 13–15). *p < .05 versus each group Because ATP turnover-related OCR was improved, we measured intracellular ATP levels in the Aβ- and β-lactolin-treated cells. Treatment with Aβ (5 μM) significantly reduced ATP concentration compared with the control group, and treatment with β-lactolin (100 nM) significantly increased ATP levels compared with the Aβ-treated group in a dose-dependent manner (F[4,13] = 8.962, p = .001; Figure 2). Taken together, treatment with β-lactolin improves mitochondrial respiration and in ATP production in Aβ-treated neuronal cell line. FIGURE 2Open in figure viewer The effect of β-lactolin on ATP concentration in Aβ-treated HT22 neuronal cells. Intracellular ATP levels were measured following a luminescence detection procedure. HT22 cells were treated with β-lactolin (1–100 nM) for 1 h and Aβ (5 μM) was added for the next 23 h. Data are presented as means ± SEM (n = 6). **p < .01, *p < .05 versus each group β-Lactolin improves mitochondrial morphologies and membrane potential in Aβ-treated neuronal cell line Next we examined the effect of β-lactolin treatment on Aβ-induced mitochondrial morphological changes. HT22 cells treated with Aβ and β-lactolin were stained using MitoTracker Green FM, and images of mitochondria were analyzed (Figure 3A). The mean area of each mitochondrion was significantly less in the Aβ (1 μM)-treated group compared with the control group. Treatment with β-lactolin (100 nM), on the other hand, significantly increased mitochondrial area compared with the Aβ-treated group (F[3,41] = 4.056, p = .013; Figure 3B). This data suggests that β-lactolin improves mitochondrial fragmentation in Aβ-treated cell. FIGURE 3Open in figure viewer The effect of β-lactolin on mitochondria morhpologies in Aβ-treated HT22 neuronal cells. (A) HT22 cells were treated with β-lactolin (1–100 nM) for 1 h, Aβ was added (1 μM) for the next 23 h, and then cells were stained with MitoTracker Green FM dye to visualize mitochondrial morphologies (upper panels). Regions of mitochondria were extracted with the sliding parabola function of Harmony software (lower panels). (B) Mitochondrial areas were evaluated using Harmony software. Nine fields were analyzed for each well, and at least 100 cells were analyzed per well. Mean mitochondrial area in each well was calculated and handled as one data sample. Data are presented as means ± SEM (n = 10–12). *p < .05 versus each group. Scale bar: 10 μm Because destruction of mitochondrial morphology reduces the mitochondrial membrane potential, we examined the effects of β-lactolin treatment on the mitochondrial membrane potential using JC-1 dye (Figure 4A). The ratio of polymer JC-1 (higher membrane potential) to monomer JC-1 (lower membrane potential) was lower in Aβ-treated cell compared with control cells, although no significant change was observed. Treatment with β-lactolin (100 nM) significantly increased the polymer to monomer ratio compared with the ratio of the Aβ-treated group (F[4,23] = 3.193, p = .032; Figure 4B). The population of cells with polymer to monomer ratio >1.2 was also significantly increased in the β-lactolin (1, 10, 100 nM)-treated group compared with the Aβ-treated group, although we did not observe a significant decrease in the Aβ-treated group compared with the control group (F[4,23] = 5.695, p = .002; Figure 4C). These results suggest that treatment with β-lactolin increases mitochondrial membrane potential. FIGURE 4Open in figure viewer The effect of β-lactolin on membrane potential in Aβ-treated HT22 neuronal cells. (A) HT22 cells were stained with JC-1 dye to evaluate mitochondrial membrane potential. JC-1 dye accumulates in mitochondrial membranes and emits green fluorescence when it exists as a monomer (Ex/Em = 514/529) at low membrane potentials (lower panels). The dye conjugates into a polymer and emits red fluorescence (Ex/Em = 514/590) at high membrane potentials (upper panels). (B) The ratio of JC-1 polymer/monomer fluorescence intensity was calculated. (C) The population of cells with polymer/monomer ratio >1.2 was measured. Nine fields were analyzed for each well, and at least 100 cells were analyzed per well. Mean mitochondrial intensity and the ratio in each well were calculated and handled as one data sample. Data are presented as means ± SEM (n = 4). *p < .05 versus each group. Scale bar: 50 μm β-Lactolin suppresses mitochondrial oxidative stress and neuronal cell death in Aβ-treated neuronal cell line Abnormal mitochondrial morphology leads to mitochondrial oxidative stress and subsequent neuronal cell death, so we asked whether or not β-lactolin reduces mitochondrial ROS production. Mitochondrial ROS were evaluated by analyzing the intensity ratio of MitoSOX to MitoTracker Green FM (Figure 5A). Treatment with Aβ (1 μM) significantly increased the MitoSOX to MitoTracker ratio compared with the control ratio. In turn, the ratio was significantly lower in β-lactolin (100 nM)-treated group (F[3,12] = 9.621, p = .002; Figure 5B). The population of cells whose ratio of MitoSOX/MitoTracker Green intensity was <1.0 was determined. We observed a significant decrease with Aβ treatment that was increased by treatment with β-lactolin (F[3,12] = 11.205, p = .001; Figure 5C). The whole-cell ROS level was also evaluated using the CM-H2-DCFDA dye, but there was no significant difference between each group (Figure S2). These results indicate that treatment