Transcriptional Regulation of Uterine Vascular Endothelial Growth Factor during Early Gestation in a Carnivore Model, Mustela vison

Vascular endothelial growth factor (VEGF) is an essential angiogenic signaling element that acts through its two tyrosine kinase receptors, inducing both proliferation of endothelial cells and vascular permeability. Given the importance of vasculogenesis and angiogenesis to early pregnancy, it is of interest to understand the mechanisms regulating vascular development at this stage. We previously demonstrated that VEGF and receptors are up-regulated during embryo implantation in an unique animal model, the mink, a species displaying obligate embryonic diapause. Herein we examined the role of prostaglandin E2 (PGE2) as a regulator of VEGF during early pregnancy and established the mechanisms of this regulation. We demonstrate that activated embryos secrete PGE2 and that expression of PGE synthase protein in the uterus is dependent upon direct contact with invading trophoblast cells during implantation. Using mink uterine stromal cells transfected with mink VEGF promoter driving the luciferase reporter gene, we show that PGE2 induces promoter transactivation and that this response can be eliminated by blockade of protein kinase A. Treatment with antagonists to PGE2 receptors EP2 and EP4 eliminated the PGE2-induced response in transfected cells. Deletional studies of the promoter revealed that a region of 99 bp upstream of the transcription start site is required for PGE2-induced transactivation. Mutation of an AP2/Sp1 cluster, found within the 99 bp, completely eliminated the PGE2 response. Furthermore, chromatin immunoprecipitation assays confirmed binding of the AP2 and Sp1 transcription factors to the endogenous mink VEGF promoter in uterine cells. PGE2 stimulated acetylation of histone H3 associated with the promoter region containing the AP2/Sp1 cluster. Taken together, these results demonstrate that PGE2 plays an important role in regulating uterine and thus placental vascular development, acting through its receptors EP2 and EP4, provoking protein kinase A activation of AP2 and Sp1 as well as acetylation of histone H3 to transactivate the VEGF promoter. Vascular endothelial growth factor (VEGF) is an essential angiogenic signaling element that acts through its two tyrosine kinase receptors, inducing both proliferation of endothelial cells and vascular permeability. Given the importance of vasculogenesis and angiogenesis to early pregnancy, it is of interest to understand the mechanisms regulating vascular development at this stage. We previously demonstrated that VEGF and receptors are up-regulated during embryo implantation in an unique animal model, the mink, a species displaying obligate embryonic diapause. Herein we examined the role of prostaglandin E2 (PGE2) as a regulator of VEGF during early pregnancy and established the mechanisms of this regulation. We demonstrate that activated embryos secrete PGE2 and that expression of PGE synthase protein in the uterus is dependent upon direct contact with invading trophoblast cells during implantation. Using mink uterine stromal cells transfected with mink VEGF promoter driving the luciferase reporter gene, we show that PGE2 induces promoter transactivation and that this response can be eliminated by blockade of protein kinase A. Treatment with antagonists to PGE2 receptors EP2 and EP4 eliminated the PGE2-induced response in transfected cells. Deletional studies of the promoter revealed that a region of 99 bp upstream of the transcription start site is required for PGE2-induced transactivation. Mutation of an AP2/Sp1 cluster, found within the 99 bp, completely eliminated the PGE2 response. Furthermore, chromatin immunoprecipitation assays confirmed binding of the AP2 and Sp1 transcription factors to the endogenous mink VEGF promoter in uterine cells. PGE2 stimulated acetylation of histone H3 associated with the promoter region containing the AP2/Sp1 cluster. Taken together, these results demonstrate that PGE2 plays an important role in regulating uterine and thus placental vascular development, acting through its receptors EP2 and EP4, provoking protein kinase A activation of AP2 and Sp1 as well as acetylation of histone H3 to transactivate the VEGF promoter. Prostaglandin E2 (PGE2) 2The abbreviations used are: PGE, prostaglandin E; COX, cyclooxygenase; VEGF, vascular endothelial growth factor; PKA, protein kinase A; ChIP, chromatin immunoprecipitation; RACE, rapid amplification of cDNA ends. is a prostanoid synthesized through the cyclooxygenase pathway characterized by the initial step of formation of prostaglandin H2 from arachidonic acid, catalyzed by the cyclooxygenases 1 and 2 (COX-1 and -2). Formation of PGE2 follows formation of prostaglandin H2 from arachidonic acid and is dependent on the presence of prostaglandin E synthase (PGE synthase). Two isoforms of PGE synthase have been identified; one is a cytosolic form that acts mostly on COX-1-derived prostaglandin H2. The second is a microsomal form, preferentially coupled with the inducible COX-2 induction of PGE2 generation (1Murakami M. Naraba H. Tanioka T. Semmyo N. Nakatani Y. Kojima F. Ikeda T. Fueki M. Ueno A. Oh S. Kudo I. J. Biol. Chem. 2000; 275: 32783-32792Abstract Full Text Full Text PDF PubMed Scopus (856) Google Scholar). PGE2 exerts its effects following binding to specific receptors containing seven transmembrane domains (2Narumiya S. Sugimoto Y. Ushikubi F. Physiol. Rev. 1999; 79: 1193-1226Crossref PubMed Scopus (0) Google Scholar). Four receptor subtypes have been identified to date: EP1, -2, -3, and -4, each activating different intracellular pathways. Knock-out models for each subtype have been investigated, and mice deficient for EP2 presented impaired ovulation and fertilization (3Tilley S.L. Audoly L.P. Hicks E.H. Kim H.S. Flannery P.J. Coffman T.M. Koller B.H. J. Clin. Invest. 1999; 103: 1539-1545Crossref PubMed Scopus (215) Google Scholar). The role of prostaglandins in reproductive processes has been extensively investigated. COX-2-deficient mice have impaired ovulation, fertilization, implantation, and decidualization (4Lim H. Paria B.C. Das S.K. Dinchuk J.E. Langenbach R. Trzaskos J.M. Dey S.K. Cell. 1997; 91: 197-208Abstract Full Text Full Text PDF PubMed Scopus (1262) Google Scholar). PGE2 is luteoprotective (5Arosh J.A. Banu S.K. Chapdelaine P. Madore E. Sirois J. Fortier M.A. Endocrinology. 2004; 145: 2551-2560Crossref PubMed Scopus (187) Google Scholar); it also plays a role in regulation of immune responses at the site of embryo attachment (6Lala P.K. Am. J. Reprod. Immunol. 1989; 20: 147-152Crossref PubMed Scopus (18) Google Scholar), in ovulation (7Matsumoto H. Ma W. Smalley W. Trzaskos J. Breyer R.M. Dey S.K. Biol. Reprod. 2001; 64: 1557-1565Crossref PubMed Scopus (133) Google Scholar), and in the decidualization process in rats (8Johnston M.E. Kennedy T.G. Biol. Reprod. 1984; 31: 959-966Crossref PubMed Scopus (11) Google Scholar, 9Kennedy T.G. Doktorcik P.E. Prostaglandins. 1988; 35: 207-219Crossref PubMed Scopus (24) Google Scholar). Recently, Wang et al. (10Wang X. Su Y. Deb K. Raposo M. Morrow J.D. Reese J. Paria B.C. J. Biol. Chem. 2004; 279: 30579-30587Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar) identified PGE2 as the major prostaglandin at implantation sites in hamsters, and expression of microsomal PGE synthase was correlated with expression of COX-2. In mice, both microsomal PGE synthase mRNA and protein were localized in the subluminal stroma surrounding the implanting blastocyst (11Ni H. Sun T. Ding N.Z. Ma X.H. Yang Z.M. Biol. Reprod. 2002; 67: 351-358Crossref PubMed Scopus (86) Google Scholar). The authors suggested embryonic induction of local PGE synthase, since expression of the enzyme was absent in pseudopregnant females as well as at interimplantation sites in the uterus. Early pregnancy in mammals is associated with morphological and functional changes in uterine cells, accompanied by vascular remodeling. These changes are required for both placental and embryonic development (12Breier G. Albrecht U. Sterrer S. Risau W. Development. 1992; 114: 521-532Crossref PubMed Google Scholar, 13Klauber N. Rohan R.M. Flynn E. D'Amato R.J. Nat. Med. 1997; 3: 443-446Crossref PubMed Scopus (179) Google Scholar, 14Risau W. Nature. 1997; 386: 671-674Crossref PubMed Scopus (4846) Google Scholar, 15Smith S.K. Hum. Reprod. Update. 1998; 4: 509-519Crossref PubMed Scopus (193) Google Scholar). Vascular endothelial growth factor (VEGF) is the major regulator of angiogenesis (16Ferrara N. Davis-Smyth T. Endocr. Rev. 1997; 18: 4-25Crossref PubMed Scopus (3668) Google Scholar) and is an important factor in regulation of the events of early implantation and establishment of the placenta (17Matsumoto H. Ma W.G. Daikoku T. Zhao X. Paria B.C. Das S.K. Trzaskos J.M. Dey S.K. J. Biol. Chem. 2002; 277: 29260-29267Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). VEGF is a homodimeric glycoprotein of 40-45 kDa, and, while best known for its potent endothelial cell-specific mitogenic activity, it also plays a role in increasing vascular permeability (18Ferrara N. Henzel W.J. Biochem. Biophys. Res. Commun. 1989; 161: 851-858Crossref PubMed Scopus (2011) Google Scholar, 19Gospodarowicz D. Abraham J.A. Schilling J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7311-7315Crossref PubMed Scopus (555) Google Scholar, 20Keck P.J. Hauser S.D. Krivi G. Sanzo K. Warren T. Feder J. Connolly D.T. Science. 1989; 246: 1309-1312Crossref PubMed Scopus (1801) Google Scholar, 21Leung D.W. Cachianes G. Kuang W.J. Goeddel D.V. Ferrara N. Science. 1989; 246: 1306-1309Crossref PubMed Scopus (4450) Google Scholar). Prostaglandins are among the factors reported to regulate VEGF (22Gately S. Cancer Metastasis Rev. 2000; 19: 19-27Crossref PubMed Scopus (345) Google Scholar). VEGF effects on angiogenesis are dependent upon binding to tyrosine kinase receptors, Flt-1 (Fms-like tyrosine kinase, also known as VEGFR-1) and KDR (kinase domain region, also known as VEGFR-2) (23Jussila L. Alitalo K. Physiol. Rev. 2002; 82: 673-700Crossref PubMed Scopus (352) Google Scholar). We have previously demonstrated that VEGF and its receptors are up-regulated during peri-implantation stages of gestation in the mink uterus (24Lopes F.L. Desmarais J. Gevry N.Y. Ledoux S. Murphy B.D. Biol. Reprod. 2003; 68: 1926-1933Crossref PubMed Scopus (29) Google Scholar). Earlier, Kennedy (25Kennedy T.G. Biol. Reprod. 1979; 20: 560-566Crossref PubMed Scopus (67) Google Scholar) showed that PGE2 is a regulator of increased vascular permeability at implantation sites in rats. Since then, PGE2 has been shown to up-regulate VEGF in a number of tissues, including umbilical cord blood-derived mast cells (26Abdel-Majid R.M. Marshall J.S. J. Immunol. 2004; 172: 1227-1236Crossref PubMed Scopus (149) Google Scholar), colon cancer cells (27Fukuda R. Kelly B. Semenza G.L. Cancer Res. 2003; 63: 2330-2334PubMed Google Scholar), endothelial cells (28Pai R. Szabo I.L. Soreghan B.A. Atay S. Kawanaka H. Tarnawski A.S. Biochem. Biophys. Res. Commun. 2001; 286: 923-928Crossref PubMed Scopus (174) Google Scholar), human pancreatic cancer cells (29Eibl G. Bruemmer D. Okada Y. Duffy J.P. Law R.E. Reber H.A. Hines O.J. Biochem. Biophys. Res. Commun. 2003; 306: 887-897Crossref PubMed Scopus (114) Google Scholar), gastric cancer cells (30Ding Y.B. Shi R.H. Tong J.D. Li X.Y. Zhang G.X. Xiao W.M. Yang J.G. Bao Y. Wu J. Yan Z.G. Wang X.H. Exp. Oncol. 2005; 27: 108-113PubMed Google Scholar), and mouse mammary tumor cells (31Chang S.H. Liu C.H. Wu M.T. Hla T. Prostaglandins Other Lipid Mediat. 2005; 76: 48-58Crossref PubMed Scopus (35) Google Scholar). There are few investigations of PGE2 modulation of VEGF transcription, and there are no such investigations pertinent to uterine expression. In the present report, we have established the pattern of expression of PGE synthase in the uterus during early pregnancy and investigated the role of PGE2 in implantation in an unique mammalian model. We provide the first demonstration that local PGE2 regulates transcriptional activity of the VEGF gene as well as new information bearing on the mechanism of this activation. Animals and Sample Collection—All treatment protocols involving the use of animals were approved by the Comité de Déontologie, Faculté de Médecine Vétérinaire, Université de Montréal in accordance with regulations of the Canadian Council of Animal Care. Mink of the Dark and Pastel varieties were purchased and maintained on a commercial farm (A. Richard, St. Damase, Canada). Females were mated twice, 7 days apart, during the first 2 weeks of March, according to standard husbandry procedures. We and others have shown that prolactin injections terminate obligate embryonic diapause and induce embryo activation and implantation in the mink (32Papke R.L. Concannon P.W. Travis H.F. Hansel W. J. Anim. Sci. 1980; 50: 1102-1107Crossref PubMed Scopus (67) Google Scholar, 33Murphy B.D. Concannon P.W. Travis H.F. Hansel W. Biol. Reprod. 1981; 25: 487-491Crossref PubMed Scopus (73) Google Scholar, 34Martinet L. Allais C. Allain D. J. Reprod. Fertil. 1981; 29: 119-130Google Scholar), and a standard protocol consisting of daily intramuscular injections of 1 mg/kg prolactin (Sigma) was employed beginning 1 week following last mating and continuing for 12 days. Implantation takes place approximately on the 13th day after the initiation of prolactin injections, verified by the presence of uterine swellings and histological evidence of trophoblast invasion. Pseudopregnancy was induced in nonmated females by two injections of GnRH (10 μg/kg Factrel; Ayerst, Guelph, Canada) 7 days apart. Uterine tissues were collected at the early stages of implantation from randomly selected females at days 13 and 15 following the first prolactin injections as well as from pseudopregnant animals. As we have previously shown (35Murphy B.D. Rajkumar K. Gonzalez Reyna A. Silversides D.W. J. Reprod. Fertil. 1993; 47: 181-188Google Scholar), the natural increases in prolactin and consequent progesterone synthesis take place in pseudopregnant animals, and samples were therefore collected and collected at 30 days after induction of the first ovulation. Samples were frozen immediately in liquid nitrogen and stored at -70 °C until analyzed. Cell Culture—An immortalized mink uterine stromal cell line (36Moreau G.M. Arslan A. Douglas D.A. Song J. Smith L.C. Murphy B.D. Biol. Reprod. 1995; 53: 511-518Crossref PubMed Scopus (33) Google Scholar) was used for the in vitro experiments described herein. Cells were cultured in Dulbecco's modified Eagle's medium/F-12 (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen), containing 1% of penicillin/streptomycin (Invitrogen) and 0.5% of Fungizone (Invitrogen). A naturally immortalized cell line from an ovarian tumor of the mink 3D. A. Douglas and B. D. Murphy, unpublished results. was also used for transfection experiments. This cell line was maintained in Opti-MEM supplemented with 5% fetal bovine serum and the antibiotics, as above. A human breast cancer cell line, MCF-7, kindly made available by Dr. Wilson Miller was also employed. MCF-7 cells were maintained in the same medium as the mink ovarian cells described above. Embryo Collection and Radioimmunoassay for PGE2—Embryos were collected by repeated flushing of the uterine horns of females in diapause and 9 days following initial embryo activation (37Desmarais J.A. Bordignon V. Lopes F.L. Smith L.C. Murphy B.D. Biol. Reprod. 2004; 70: 662-670Crossref PubMed Scopus (37) Google Scholar) with TC-199 medium (Invitrogen) containing 10% fetal bovine serum (Invitrogen). Embryos (in groups of five) were incubated in 500 μl of INRA Menezo B2 medium (Pharmascience, Paris, France) supplemented with 5% fetal bovine serum (Invitrogen) for 48 h in the presence or absence of mink uterine cells. For radioimmunoassay, 100 μl of embryo or cell culture medium were employed. The radioimmunoassay for PGE2 was performed according to Xiao et al. (38Xiao C.W. Murphy B.D. Sirois J. Goff A.K. Biol. Reprod. 1999; 60: 656-663Crossref PubMed Scopus (61) Google Scholar). Briefly, anti-serum from Assay Design (Ann Arbor, MI) was used with reactivity of 100% with PGE2 and of 70, 1.4, 0.7, and 0.6% with PGE1, prostaglandin F1α, prostaglandin F2α, and ketoprostaglandin F1α, respectively. Assay sensitivity was 4 pg/100 μl, and the intra-assay coefficient of variation, calculated between duplicates ranged from 0.04 to 6.1%. Extraction of RNA, Purification, and Reverse Transcription— Uterine tissues were homogenized in buffer RLT (Qiagen, Mississauga, Canada) with 0.12 m β-mercaptoethanol (Sigma). Purification of RNA was performed using an RNeasy Protect Mini kit (Qiagen), following the recommendations of the manufacturer. Total RNA was measured by spectrophotometry at 260 nm, and 1 μg/sample of total RNA was used for reverse transcription with the Omniscript reverse transcription kit (Qiagen) according to the manufacturer's instructions. PCR for PGE Synthase and Receptors in the Mink Uterine Samples—Homologous sequences of rat (accession numbers: PGEs, NM_021583; EP-1, NM_013100; EP-2, NM_031088; EP-4, D28860), mouse (PGEs, NM_022415; EP-1, NM_013641; EP-2, NM_008964; EP-3, NM_011196), and human (EP-1, NM_000955; EP-2, NM_000956; EP-3, NM_000957; EP-4, NM_000958) were used to design primers for PGE synthase and for PGE receptors (Table 1). PCR products of the expected size were excised and purified using a gel extraction kit (Qiagen). Purified cDNA was ligated into a pDrive vector (Qiagen) following the manufacturer's instructions and further transformed into competent Escherichia coli strain XL-1 Blue. Plasmids were isolated with a QIAprep Spin Miniprep kit (Qiagen) and sequenced by automated DNA sequencing for verification (Service d'Analyze et de Synthèse d'Acides Nucléiques de Université Laval, Québec, Canada). PCRs were carried out in a final volume of 50 μl using Taq DNA polymerase (Amersham Biosciences). PCR products were separated in a 1.5% agarose gel and visualized with ethidium bromide.TABLE 1Sequences of oligonucleotides used to amplify PGE synthase and the EP receptorsOligonucleotide nameSequence (5′-3′)PGEs forwardGCTGCGGAAGAAGGCTTTTGPGEs reverseAGGTAGGCCACGGTGTGTACEP1 forwardGGCGGCTGCATGGTCTTCTTEP1 reverseCAGCAGATGCACGACACCACEP2 forwardGCCACGATGCTCATGCTCTTEP2 reverseGAATGAGGTGGTCCGTCTCCEP3 forwardGGAGAGCAAGCGCAAGAAGTEP3 reverseCTGATGAAGCACCACGTCCEP4 forwardATCTTCGGGGTGGTGGGCAAEP4 reverseTTGATGGCCAGGTAGCGCTC Open table in a new tab Cloning and Sequencing of the Mink VEGF 5′-Untranslated Region and Promoter Regions—The 5′-flanking region of the mink VEGF gene was cloned by PCR using the Universal Genome Walker Kit (Clontech) from a library constructed from mink genomic DNA. The Expand High Fidelity kit served for amplification. The PCR products were cloned into a pGEM-T vector (Qiagen) for sequencing, which was performed by automated DNA sequencing (Service d'Analyze et de Synthèse d'Acides Nucléiques de Université Laval). Sequence analysis was undertaken using MatInspector (Abteilung Genetek, Braunschweig, Germany) and TF Search (Yukata Akiyama; TF Search: Searching TF Binding Sites). The transcription start site of the VEGF gene was predicted using the program for promoter prediction of the Berkeley Drosophila Genome Project (University of California, Berkeley, CA). To confirm prediction, we employed the 5′/3′-RACE kit (Roche Applied Science) to identify the site of transcription initiation from 2.9 kb of the mink 5′-flanking region. Primers for amplification are described in Table 2.TABLE 2Oligonucleotides employed for 5′-RACE and ChIPOligonucleotide nameSequence (5′-3′)5′RACE-Sp1TTGACCCTGTCCCTGTCGTTGC5′RACE-Sp2CTCTGACCCCGTCTCTCTCTCT5′RACE-Sp3GGGGAAGTAAAGGAGCGATCTCChIP-forwardCAGGGGTCACGCCAGTATTCCAChIP-reverseCCTCTGCGCTCCCTACCACTA Open table in a new tab Immunohistochemical Analysis of Microsomal PGE Synthase— Tissues fixed in 4% paraformaldehyde solution were used to demonstrate expression of PGE synthase during the early implantation stages. Sections were rehydrated and permeabilized with 0.2% Triton in phosphate-buffered saline. Blocking was performed for 1 h using 5% bovine serum albumin in phosphate-buffered saline, and sections were incubated overnight at 4 °C with rabbit anti-human PGE synthase (Cayman, Ann Arbor, MI) diluted 1:150 in 5% bovine serum albumin/phosphate-buffered saline. A conjugated Cy3 anti-rabbit second antibody (Jackson ImmunoResearch, West Grove, PA) was employed for 1 h to localize PGE synthase. Tissues were counterstained using 4′,6-diamidino-2-phenylindole dihydrochloride (Roche Applied Science). Normal rabbit serum was used as negative control. Plasmid Constructions—The 1.7-kb sequence of the mink VEGF gene was cloned into a pGL2 basic vector (Promega). All deletions were derived from the original construct by PCR using KPNI and XHOI insertions for directional cloning. Mutation of the predicted AP2 and Sp1 sites was performed using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). All plasmids used for transient transfection were prepared using the Maxi Prep kit (Qiagen) and sequenced prior to transfection. Transfections, Luciferase Reporter Assays, and Treatments— Just prior to transfection, culture medium was changed to Opti-MEM lacking fetal bovine serum, and antibiotics in all cell lines were used. Transfection and treatments were carried out in 24-well plates in this medium. For transient transfection, Lipofectamine 2000 (Invitrogen) was used according to the manufacturer's protocol. Cells were transfected with 400 ng/well of the pGL2 basic vector, containing the mink VEGF promoter constructs, for 5 h prior to the addition of treatments. Medium was changed following the 5 h of transfection, and treatments were added 1 h following transfection. Cells were cotransfected with the SV40 Renilla luciferase control vector pRL.SV40 (Promega) to normalize the results for transfection efficiency. Control transfections received equal amounts of the pGL2 basic vector (Promega) devoid of promoter constructs. Treatments comprised the addition of doses of PGE2 (Sigma) from 10 to 100 μm for 6-24 h. To test the role of the protein kinase A (PKA) pathway, some cultures were treated with 100 μm and 1 mm dibutyryl-cAMP (Sigma) and chlorophenylthio-cAMP (Sigma) for 12 h or the PKA inhibitor H89 (Sigma) at a dose of 10μm beginning 1 h prior to PGE2 treatment. To establish which of the PGE2 receptors were involved, antagonists for PGE2 receptors EP1 (SC19220; 10 μm; Sigma), EP2 (AH6809; 20 μm; Sigma), and EP4 (AH2384B; 30 μm; Sigma) were added to transfected cells 1 h prior to treatment with PGE2. Luciferase activity was evaluated using the dual luciferase assay system (Promega), and chemiluminescence was measured with a Berthold 9501 luminometer. Chromatin Immunoprecipitation (ChIP) Assay—ChIP assays were performed as described by Kuo and Allis (39Kuo M.H. Allis C.D. Methods. 1999; 19: 425-433Crossref PubMed Scopus (486) Google Scholar) with some modifications. Mink uterine stromal cells were plated in a 10-cm plate and treated after confluence with 75 μm PGE2 for 6 h. Prior to treatment, cells were serum-starved for 20 h. Following treatment, DNA and protein were cross-linked by the addition of formaldehyde to the medium at a final concentration of 1% for 10 min at 37 °C. Cells were then washed in phosphate-buffered saline, resuspended in 200 μl of ChIP lysis buffer (1% SDS, 10 mm EDTA, 50 mm Tris-HCl (pH 8.0), and protease inhibitors), and sonicated with a Branson Sonifier 450 (Danbury, CT) at power setting 2 with 10-s pulses at duty cycle 90. ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris, pH 8.1, 16.7 mm NaCl, and protease inhibitors) was used to dilute the chromatin solution 10-fold. Total DNA used for controlling the amount of DNA/sample was purified from one-tenth of the lysate. Each sample was precleared by incubating with 80 μl of salmon sperm DNA/protein A-agarose 50% gel slurry (Upstate Biotechnology, Inc., Lake Placid, NY) for 30 min at 4 °C. Anti-acetyl histone H-3 (5 μg; Upstate Biotechnology), anti-AP2 (5 μg; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-Sp1 (5 μg; Santa Cruz Biotechnology), and rabbit IgG (as negative controls) were added and immunoprecipitated at 4 °C overnight. The immunoprecipitate was collected using salmon sperm DNA/protein A-agarose and washed once with buffers in the following order: low salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris-HCl, pH 8.1, 150 mm NaCl), high salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris-HCl, pH 8.1, 500 mm NaCl), LiCl wash buffer (0.25 m LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mm EDTA, 10 mm Tris-HCl, pH 8.1); TE (10 mm Tris-HCl, pH 8.0, 1 mm EDTA). The DNA-protein or histone cross-links were reversed by incubation at 65 °C for 4 h followed by proteinase K treatment. DNA was then recovered and purified with the Qiaquik PCR purification column (Qiagen). PCR was carried with an annealing temperature of 61 °C. The primers used for the PCR are depicted in Table 2. Primers derived from the open reading frame of the gene were employed as controls. PCR products were separated on a 1.5% agarose gel, and ethidium bromide was used for visualization. Statistical Analysis—The relative luciferase activity throughout this study was analyzed using the least squares analysis of variance and the general linear model procedures of SAS (Cary, NC). When significant differences in treatments were found, comparisons of means were further performed by the methods of orthogonal contrasts and the Duncan multiple range test. A probability level of p < 0.05 was considered significant. Embryonic Production of PGE2—Embryos collected during the diapause and activation stages were incubated in the presence or absence of mink uterine cells to determine their capability to produce PGE2. Embryos in diapause failed to produce and/or secrete detectable levels of PGE2. The embryos collected following activation by prolactin treatment and that were therefore in active growth (37Desmarais J.A. Bordignon V. Lopes F.L. Smith L.C. Murphy B.D. Biol. Reprod. 2004; 70: 662-670Crossref PubMed Scopus (37) Google Scholar) produced copious quantities of PGE2 (Fig. 1A), either alone or in co-culture with uterine cells. Uterine cells alone failed to produce this prostaglandin. Expression of PGE Synthase and EP Receptor mRNA in the Uterus— Uterine tissues collected from implantation and interimplantation sites as well as uteri collected from pseudopregnant females contained mRNA for PGE synthase. The abundance of mRNA for this enzyme was ∼7-fold greater in tissues collected from the implantation sites, composed of both embryonic and uterine components, at 3-4 days following implantation compared with all other uterine samples studied (Fig. 1B). EP1 receptor expression was negligible, whereas the receptors of the EP2 and EP4 subtypes were expressed at all stages and locations collected, with no apparent difference among the samples (Fig. 1B). The EP3 receptor mRNA was not detected at any of the sites or stages investigated (data not shown). Immunohistochemical Localization of PGE Synthase in the Pregnant Mink Uterus—Given the increased expression of the PGE synthase observed at implantation sites (Fig. 1B), we were interested in establishing whether it was of uterine or embryonic origin. We found the PGE synthase protein to be present in the myometrium of all stages evaluated (Fig. 2E). In the endometrium, PGE synthase was localized in the stromal layer immediately surrounding the implanting embryo (Fig. 2, A-C), whereas no significant localization was observed in the uterine tissue opposite to the invading trophoblasts (Fig. 2D). Histological sections from interimplantation sites further confirmed that pattern, in that endometrial cells in these regions, lacking direct contact with embryonic tissue, did not express this protein (Fig. 2, E and F). Cloning and Sequencing of the 5′-Flanking Region of the Mink VEGF Gene—A 2.9-kb sequence upstream of the ATG triplet was identified by means of the Genome Walker kit (Clontech) (accession number DQ381737). The transcription initiation site at 1058 bp upstream of the ATG triplet was predicted by means of the promoter prediction program of the Berkeley Drosophila Genome Project and confirmed by 5′-RACE using the RNA of three different mink samples, two of uterine and one of ovarian origin. The VEGF proximal promoter region in the mink bears a high homology to the human (81%) and mouse sequences (72%) (accession numbers AF095785 and U41383, respectively). Matinspector analysis of the mink promoter sequence identified several potential response element sequences previously identified in the human and mouse VEGF promoters, AP1, AP2, and Sp1, among others. Concurring with the human and mouse counterparts, there was no consensus TATA box motif present, whereas an important GC-rich region was found in the proximal promoter region, about 70 bp upstream of the transcription start site. PGE2 Induces VEGF Transcription—We employed the reporter gene luciferase driven by the mink VEGF proximal promoter in mink uterine stromal cells. We observed that PGE2 was capable of inducing a 3-fold induction in transcription of the reporter gene, in response to the doses of 75 and 100 μm (p < 0.05), and a 2-fold induction to the dose of 50 μm, whereas 10 μm resulted in a modest but nonsignificant 50% elevation (Fig. 3A). Similar levels of induction were observed at the three different times tested, 6, 12, and 24 h of PGE2 treatment (Fig. 3B). Furthermore, we tested transfection of other cell types and consequent response to prostaglandin treatment in the form of induction of VEGF