Tamoxifen Induces Rapid, Reversible Atrophy, and Metaplasia in Mouse Stomach

Tamoxifen, a selective estrogen receptor modulator, is widely used in research and clinically in patients. We find that treatment of normal mice with a single ≥3 mg/20 g body weight dose of tamoxifen leads to apoptosis of >90% of all gastric parietal cells (PCs) and metaplasia of zymogenic chief cells within 3 days. Remarkably, gastric histology returns to nearly normal by 3 weeks. Tamoxifen toxicity occurs by oral and intraperitoneal administration, in both sexes, in multiple strains, and does not depend on estrogen, though acid secretion inhibition is partially protective. Thus, substantial gastric toxicity is a heretofore unappreciated tamoxifen side effect. Tamoxifen, a selective estrogen receptor modulator, is widely used in research and clinically in patients. We find that treatment of normal mice with a single ≥3 mg/20 g body weight dose of tamoxifen leads to apoptosis of >90% of all gastric parietal cells (PCs) and metaplasia of zymogenic chief cells within 3 days. Remarkably, gastric histology returns to nearly normal by 3 weeks. Tamoxifen toxicity occurs by oral and intraperitoneal administration, in both sexes, in multiple strains, and does not depend on estrogen, though acid secretion inhibition is partially protective. Thus, substantial gastric toxicity is a heretofore unappreciated tamoxifen side effect. Tamoxifen is widely used to spatiotemporally delete mouse genes using the CreERT/loxP system.1Feil R. et al.Proc Natl Acad Sci U S A. 1996; 93: 10887-10890Crossref PubMed Scopus (677) Google Scholar Tamoxifen is also used clinically as a selective estrogen receptor (ER) modulator, in chemotherapeutic, anti-osteoporotic, and several other therapeutic regimens.2Jordan V.C. Cancer. 1992; 70: 977-982PubMed Google Scholar, 3Love R.R. et al.N Engl J Med. 1992; 326: 852-856Crossref PubMed Scopus (1007) Google Scholar Some reports suggest tamoxifen also increases risk for subsequent gastric cancer.4Chandanos E. et al.Br J Cancer. 2006; 95: 118-122Crossref PubMed Scopus (41) Google Scholar, 5Matsuyama Y. et al.Ann Oncol. 2000; 11: 1537-1543Abstract Full Text PDF PubMed Scopus (57) Google Scholar Most gastric cancers occur in stomachs colonized by Helicobacter pylori.6Helicobacter and Cancer Collaborative GroupGut. 2001; 49: 347-353Crossref PubMed Scopus (858) Google Scholar Precancerous effects of bacterial colonization include death (atrophy) of acid-secreting gastric PCs, differentiation changes (metaplasia) in the digestive-enzyme–secreting zymogenic (chief) cell lineage (ZC) and increased stem cell proliferation.7Lennerz J.K. et al.Am J Pathol. 2010; 177: 1514-1533Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 8Lee H.J. et al.Gastroenterology. 2010; 139 (e3): 213-225Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar In control experiments for tamoxifen induction of Cre-recombinase activity,9Huh W.J. et al.Am J Physiol Gastrointest Liver Physiol. 2010; 299: G368-G380Crossref PubMed Scopus (0) Google Scholar we noticed that tamoxifen injection (3 consecutive days, intraperitoneal, 5 mg/20g mouse body weight) caused dramatic rearrangement of the gastric mucosa, with loss of >90% of PCs, a 6-fold increase in proliferation in stem/progenitor cells, and morphological changes in the ZCs in the bases of gastric-units (Figure 1A−D). By 14−21 days, the epithelium recovered (Figure 1A). No other organs had marked phenotypes at this dose or time-schedule (Supplementary Figure 1). Even a single dose of tamoxifen by intraperitoneal injection or oral gavage from 2 different commercial suppliers in 3 different strains of mice caused similar effects in >63 mice (Figure 1E, Supplementary Figure 2A−F). By quantitative reverse transcription polymerase chain reaction, PC-specific transcripts (Atp4a) and markers of ZC maturation (Mist1 aka Bhlha15, Pgc, GIF)10Bredemeyer A.J. et al.Dev Biol. 2009; 325: 211-224Crossref PubMed Scopus (69) Google Scholar were significantly reduced by day 3, whereas the surface/foveolar lineage marker (Tff1) and transcripts for gastrin were unchanged (Figure 1F, see Supplementary Figure 2G for Western blots of GIF and ATP4A). Increased progenitor cell proliferation and changes in ZC differentiation are characteristic of spasmolytic polypeptide expressing metaplasia (SPEM).8Lee H.J. et al.Gastroenterology. 2010; 139 (e3): 213-225Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 11Quante M. et al.Gastroenterology. 2010; 139 (e2): 2018-2027Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar In SPEM, expression of mucous neck cell markers (like spasmolytic polypeptide, ie, TFF2) occurs in the base of glands, where ZCs normally reside.10Bredemeyer A.J. et al.Dev Biol. 2009; 325: 211-224Crossref PubMed Scopus (69) Google Scholar, 11Quante M. et al.Gastroenterology. 2010; 139 (e2): 2018-2027Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar Consistent with the SPEM phenotype, tamoxifen caused a marked increase in basal neck cell marker expression (Supplementary Figure 3). Additionally, tamoxifen increased 2 SPEM-specific transcripts, He4 and Lyz8Lee H.J. et al.Gastroenterology. 2010; 139 (e3): 213-225Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar; however, transcript levels for spasmolytic polypeptide(Tff2) itself were unchanged (Figure 1F). SPEM is usually diagnosed by histopathological criteria and not transcriptionally,7Lennerz J.K. et al.Am J Pathol. 2010; 177: 1514-1533Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 8Lee H.J. et al.Gastroenterology. 2010; 139 (e3): 213-225Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 10Bredemeyer A.J. et al.Dev Biol. 2009; 325: 211-224Crossref PubMed Scopus (69) Google Scholar, 11Quante M. et al.Gastroenterology. 2010; 139 (e2): 2018-2027Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 12Ogawa M. et al.Dig Dis Sci. 2006; 51: 431-439Crossref PubMed Scopus (11) Google Scholar but we cannot rule out the possibility that the lack of increased Tff2 indicates that tamoxifen-induced metaplasia is a SPEM variant. In humans and mice, metaplasia always occurs in the setting of PC atrophy,8Lee H.J. et al.Gastroenterology. 2010; 139 (e3): 213-225Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 10Bredemeyer A.J. et al.Dev Biol. 2009; 325: 211-224Crossref PubMed Scopus (69) Google Scholar To assess PC death, we crossed Atp4b-Cre mice, whose PCs constitutively express Cre,13Syder A.J. et al.Proc Natl Acad Sci U S A. 2004; 101: 4471-4476Crossref PubMed Scopus (88) Google Scholar to nuclear lacZ-R26R mice. In these mice, all mature PCs had, as expected, nuclear lacZ expression (Figure 2A). Tamoxifen caused near complete loss of lacZ, indicating that PCs died and did not give rise to other cells with different morphological or molecular characteristics. Terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling–positive PCs were not observed in the vehicle-treated controls, whereas they were common within 12 hours after a single injection of 5 mg/20 g tamoxifen (Figure 2B). By 12 hours, cytochrome C staining could now be found leaked into the cytoplasm of the majority of PCs, consistent with early apoptosis; in controls, distribution was still punctate, consistent with retention in the mitochondria (Figure 2B). By transmission electron microscopy, PCs showed neither vacuolization nor organellar swelling, characteristics of necrotic death, but had apoptotic features like electron-dense inclusions in mitochondria and peripheral chromatin condensation (Figure 2D, E). Finally, only tamoxifen-treated stomachs showed caspase-3 cleavage (Figure 2C). Tamoxifen can function as both an ER agonist and antagonist, depending on tissue type; however, neither treatment with the pure ER agonist 17-β-estradiol nor the specific antagonist fulvestrant induced atrophy/metaplasia. And neither blocked tamoxifen effects (Supplementary Figure 4A, B). Sex of the mice also did not affect tamoxifen effects (Supplementary Figure 4C), nor did ovarectomy of females to block endogenous estrogen production (Supplementary Figure 4C; data not shown). However, tamoxifen effects could largely be reversed by blocking the PC proton pump with omeprazole (Supplementary Figure 5), suggesting a role for active acid secretion in tamoxifen toxicity to PCs. Finally, another selective ER modulator family member, raloxifene, which also has both pro- and anti-estrogenic effects, did not cause atrophy up to a dose of 5 mg/20 g (Supplementary Figure 4D), indicating toxicity is not a general feature of selective ER modulators. On the other hand, intraperitoneal injection of raloxifene induced Cre recombinase–mediated lacZ activation in mice expressing Rosa26-Cre fused with a modified ER (Supplementary Figure 4E), indicating that raloxifene can be used to induce Cre recombinase activity to obviate the off-target toxicity of tamoxifen in Cre-loxP inducible systems. Tamoxifen is a chemotherapeutic drug that has toxic effects on cancer cells from diverse tissues. In osteoclasts (which, like PCs, are large, mitochondria- and proton pump-rich cells), toxicity is caused by disrupting proton gradients and thereby intracellular pH.14Lehenkari P. et al.J Bone Miner Res. 2003; 18: 473-481Crossref PubMed Scopus (26) Google Scholar The drug DMP-777 causes PC death the same way.12Ogawa M. et al.Dig Dis Sci. 2006; 51: 431-439Crossref PubMed Scopus (11) Google Scholar Omeprazole is partially protective against both DMP-777 and tamoxifen toxicity, suggesting a similar mode of action.12Ogawa M. et al.Dig Dis Sci. 2006; 51: 431-439Crossref PubMed Scopus (11) Google Scholar The minimal dosing that causes metaplasia in the current study is an order of magnitude more than the equivalent (40 mg/day) used therapeutically in humans.15Reagan-Shaw S. et al.FASEB J. 2008; 22: 659-661Crossref PubMed Scopus (4338) Google Scholar Acute loss of PCs in patients taking tamoxifen might be beneficial for acid-reflux–associated illness, but could also predispose long-term to gastric cancer. Further experiments are clearly needed to address effects of tamoxifen on the human stomach. Drs Huh and Khurana contributed equally to this work. All experiments involving animals were performed according to protocols approved by the Washington University School of Medicine Animal Studies Committee. Mice were maintained in a specified-pathogen-free barrier facility under a 12 hour light cycle. Wild type C57BL/6, BALB/c and FVB/N mice were purchased from The Jackson Laboratory. To trace parietal cells (PCs), H+/K+ ATPase-Cre mice1Syder A.J. et al.Mol Cell. 1999; 3: 263-274Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar were crossed with a reporter line, B6.129-Gt(ROSA)26Sortm1Joe/J (The Jackson Laboratory)2Stoller J.Z. et al.Genesis. 2008; 46: 200-204Crossref PubMed Scopus (40) Google Scholar, which expresses floxed β-galactosidase in the nucleus under the control of the Rosa26 promoter. Tamoxifen (1–5mg/20g body weight, Sigma, St. Louis, MO; and in 1 experiment, 5mg/20g, Cayman Chemical Company, MI) was injected intraperitoneally for one or three days to induce SPEM and mice were dissected at 12 hours, 3 days, 7 days, 14 days, 21 days and 28 days after treatment. Tamoxifen was dissolved in a vehicle of 10% ethanol and 90% sunflower seed oil (Sigma). Tamoxifen stock concentrations ranged from 5mg/ml to 2mg/ml; 200μl/20g body weight was injected intraperitoneally. Each mouse was orally gavaged with 4mg tamoxifen, prepared in the same vehicle described above, for 3 days and dissected at day 3. Fulvestrant (Sigma; 3mg/20g body weight, dissolved in the same vehicle as tamoxifen) and 17 β-estradiol (Sigma; 50μg/20g body weight, dissolved in the same vehicle as tamoxifen to stock concentration of 100ng/100μl) were injected subcutaneously every day for three days, with or without one injection of 5mg/20g tamoxifen on the first day; stomachs were harvested 3 days after the first injection. Omeprazole (Sigma; 1.5mg/20g body weight) was dissolved in 100 μl DMSO (Sigma) in 90 μl 1% methyl cellulose (Sigma) and orally gavaged every day for four days, with or without one injection of 5mg/20g tamoxifen on the second day of gavaging, with harvesting at 3 days after tamoxifen injection. Raloxifene (Sigma; 5mg/20g body weight) was dissolved in 10% DMSO and 90% sunflower seed oil and injected into wildtype mice for 3 days and dissected on day 3. To evaluate efficiency of recombination, R26CreERT3Huh W.J. et al.Am J Physiol Gastrointest Liver Physiol. 2010; 299: G368-G380Crossref PubMed Scopus (55) Google Scholar mice were crossed with B6.129-Gt(ROSA)26Sortm1Joe/J (The Jackson Laboratory)2Stoller J.Z. et al.Genesis. 2008; 46: 200-204Crossref PubMed Scopus (40) Google Scholar and injected with 2mg/20g body weight raloxifene for 5 days, dissected at day 14 and stained for LacZ. Stomachs were prepared, and stained, and imaged using methods modified from Ramsey et al4Ramsey V.G. et al.Development. 2007; 134: 211-222Crossref PubMed Scopus (148) Google Scholar. Primary antibodies used for immunostaining were: rabbit (1:10,000), goat (1:2000) anti-human gastric intrinsic factor (gifts of Dr. David Alpers, Washington University), rabbit anti-H+/K+ ATPase α subunit (1:10,000, Dr. Michael Caplan, Yale University), goat anti-BrdU (1:20,000, Jeffrey Gordon, Washington University), rabbit anti-Cytochrome C (1:100, Cell Signaling Technology). Secondary antibodies, GSII lectin and BrdU labeling were as described4Ramsey V.G. et al.Development. 2007; 134: 211-222Crossref PubMed Scopus (148) Google Scholar. For PCR, tissue was lysed with 25mM sodium hydroxide (pH 12.0) at 95°C for 25 minute and neutralized with the same volume of 40mM Tris buffer (pH 5.0) For Cre, PCR was with RedTaq (Sigma), and KlenTaq (DNA Polymerase Facility, Washington University, St. Louis, MO) was used for LacZ PCR. Primers: Cre forward: AGG GAT CGC CAG GCG TTT TC and reverse: GTT TTC TTT TCG GAT CCG CC, LacZ forward: GTT GCA GTG CAC GGC AGA TAC ACT TGC TGA and reverse: GCC ACT GGT GTG GGC CAT AAT TCA ATT CGC. LacZ staining was modified from Lobe, et al, 19995Lobe C.G. et al.Dev Biol. 1999; 208: 281-292Crossref PubMed Scopus (451) Google Scholar. Tissue was fixed in LacZ fix for 4 hours at 4°C and washed in LacZ wash buffer three times. Tissue was equilibrated in 30% sucrose/PBS overnight at 4°C, was embedded in O.C.T. (Sakura, Torrance, CA) and was frozen in dry ice. The frozen block was cryosectioned at 14 μm thickness. The section was fixed again for 10 minutes in LacZ fix and washed in LacZ wash buffer three times. Then the section was incubated in LacZ stain 6 hours at 30°C and washed in PBS three times. The section was post-fixed in LacZ fix at room temperature for ten minutes, dehydrated through ethanol and xylene, counter stained with nuclear fast red (Vector Laboratories Inc., Burlingame, CA) and then mounted in Cytoseal XYL (Richard-Allan Scientific, Kalamazoo, MI). Stomachs were inflated with freshly prepared formalin and suspended in fixative overnight at 4°C, followed by multiple rinses in 70% Ethanol, arrangement in 2% agar in a tissue cassette, and routine paraffin processing. Sections (5 μm) were deparaffinized and rehydrated, and Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was performed using the ‘In Situ Cell Death Detection Kit, Fluorescein' (Roche) according to the manufacturer's instructions. Sections were counter-stained with GS-II at 594nm (1:2000, Invitrogen). For quantitative RT-PCR (qRT-PCR) analysis, total RNAs from stomach tissue were extracted by RNAeasy Midi Kit (Qiagen, Valencia, CA). cDNA was synthesized with Superscript III (Invitrogen) and random primers. qRT-PCR was performed with SYBR Advantage qPCR Mix (Clontech, Mountain View, CA) and gene-specific primers (see table) on an Mx3000P (Stratagene, La Jolla, CA). qRT-PCR analysis and standardization was as described6Huh W.J. et al.Gastroenterology. 2010; 139: 2038-2049Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, every run was standardized to 18s rRNA primers: forward CAT TCG AAC GTC TGC CCT ATC, reverse CCT GTG CCT TCC TTG GA. Gene-specific primers used were as follows:Tabled 1Sr. No.GeneForward Primer 5′→3′Reverse Primer 5′→3′Ref.1.Tff1AGCACAAGGTGATCTGTGTCCGGAAGCCACAATTTATCCTCTCC6Huh W.J. et al.Gastroenterology. 2010; 139: 2038-2049Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar2.Atp4aTCTGCTTTGCGGGACTTGTACGGCATTTGAGCACAGCAT6Huh W.J. et al.Gastroenterology. 2010; 139: 2038-2049Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar3.Tff2TGCTCTGGTAGAGGGCGAGCGACGCTAGAGTCAAAGCAG6Huh W.J. et al.Gastroenterology. 2010; 139: 2038-2049Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar4.PgcATGAAGAGTATCCGGGAGACCTGGGCTCATAGAGTACACTGTAG6Huh W.J. et al.Gastroenterology. 2010; 139: 2038-2049Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar5.GIFCCCTCTACCTCCTAAGTGTTCTCCTGAGTCAGTCACCGAGTTCT6Huh W.J. et al.Gastroenterology. 2010; 139: 2038-2049Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar6.GastACACAACAGCCAACTATTCCAAAGTCCATCCATCCGTAG7Jain R.N. et al.J Clin Invest. 2008; 118: 2459-2470Crossref PubMed Google Scholar7.Mist1GCTGACCGCCACCATACTTACTGTGTAGAGTAGCGTTGCAGG6Huh W.J. et al.Gastroenterology. 2010; 139: 2038-2049Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar8.He4AACCAATTACGGACTGTGTGTTTCGCTCGGTCCATTAGGCT8Nam K.T. et al.Gastroenterology. 2010; 139 (e9): 2028-2037Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar9.LyzGAGACCGAAGCACCGACTATGCGGTTTTGACATTGTGTTCGC8Nam K.T. et al.Gastroenterology. 2010; 139 (e9): 2028-2037Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar Open table in a new tab For Western blot analysis, stomach tissue was frozen in liquid nitrogen and ground in urea buffer (8 M urea, 0.19 M Tris · HCl pH 6.8, 1% SDS) using PowerGen 700 homogenizer (Fischer Scientific). Proteins were separated on a 10% polyacrylamide gel (Invitrogen) and transferred to Nitrocellulose membrane (Amersham Hybond ECL). Primary antibodies used for blotting were rabbit anti- H+/K+ ATPase α subunit (1:1000, gift from Dr. Michael Caplan), rabbit anti-Gastric Intrinsic Factor (1:10,000 gift from Dr. David Alpers), rabbit- anti-Chromogranin A (1:1000, DiaSorin, Stillwater, MN), rabbit anti-Cleaved Caspase 3 (1:1000, Cell Signaling Technology) and rabbit anti-α-tubulin (1:2,000, Cell Signaling Technology). Secondary antibody was horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG (1:2,000, Santacruz Biotenchnology, Inc.). Immobilon Western Chemiluminescent HRP Substrate (Millipore) was used for detection. Cell counts were either by immunofluorescence or from H&E. For immunofluorescence, stomach sections were costained with GS-II, bisbenzimide, and either anti-H+/K+ ATPase or anti-BrdU antibody. The numbers of PCs or BrdU positive (proliferating) cells in every field were scored for five randomly selected fields in the corpus of a single mouse, with three mice in every experimental set. PCs were also counted in H&E-stained sections for every mouse used in the study. Fifty well aligned corpus gastric units were selected at random from every mouse under study, the total number of PCs determined and average PC/unit calculated. H&E counts were indistinguishable from immunofluorescence-based counts. Light and transmission electron photomicrographs were taken as described9Bredemeyer A.J. et al.Dev Biol. 2009; 325: 211-224Crossref PubMed Scopus (74) Google Scholar All graphs and statistics were performed in GraphPad Prism, using one-way ANOVA with either Dunnett's or Tukey's post-hoc multiple comparison tests for cell count data. qRT-PCR data significance was assessed by Student's t test followed by Bonferroni post hoc analysis to ensure against multiple comparison bias. Quantification of GSII and GIF immunofluorescent staining was performed using ImageJ software (http://rsbweb.nih.gov/ij/). The GSII/GIF positive region of each unit was divided lengthwise into 10 equal sections. The images were then thresholded (GSII 4–6 MFI; GIF 10–17 MFI) to subtract background. The mean fluorescent intensities (MFI) above the threshold was multiplied by the area of pixels above the threshold for both the GSII and GIF channel for each section. For tamoxifen treated day 3 and day 21, the data from 20 units from 2 mice were quantified; in untreated mice, data from 15 units from one mouse was quantified. The data for each section was averaged and plotted.Supplemental Figure 2Tamoxifen induced SPEM is dose dependent. Wild type mice injected with 1mg/20g body weight (A), or 2mg/20g body weight (B) tamoxifen for 3 days did not show parietal cell death or features of SPEM, whereas, mice treated with 3mg/30g body weight (C) for 3 days or a single injection of 5mg/20g body weight (D) tamoxifen show complete atrophy of parietal cells and SPEM histology. Other strains of mice develop SPEM equivalently on tamoxifen treatment as shown in BALB/c (E) and FVB/N (F) strains after 3 days of injection of 5mg/20g tamoxifen. G: Western blot showing decrease in H+/K+ ATPase and Intrinsic Factor (GIF, zymogenic cell marker) protein levels 3 days after tamoxifen treatment in mice, when compared with controls. Chromogranin A levels are slightly higher post tamoxifen treatment, which is consistent with previous reports of spasmolytic polypeptide expressing metaplasia (SPEM).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplemental Figure 3Tamoxifen induces spasmolytic polypeptide-expressing metaplasia (SPEM). A: photomicrographs of basal and neck zones of gastric units with mucous neck cells (green, GS-II lectin) and zymogenic cells (red, GIF) taken 3 days after vehicle treatment (above); 3 days (middle) and 21 days (below) after tamoxifen treatment. B: Neck and base zones of gastric units were analyzed for expression of neck and zymogenic cell markers as a function of distance (0 = first cell positive for neck/zymogenic markers; 100 = basal-most neck/zymogenic cell). For each unit, distance was normalized into bins representing 10% of total distance. Plotted are the products of the mean fluorescent intensity and the total area that is either GS-II (neck cell) or GIF (zymogenic cell) positive (means ± SD, across all gastric units; see Methods). Note how normal neck cell differentiation peaks, then falls off toward the base, whereas, zymogenic cells are found in the base and not the neck. Tamoxifen treatment causes neck cell marker expression in the base. The changes in neck cell (C) and zymogenic cell (D) markers for all conditions are plotted on the same axes.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplemental Figure 4SPEM induction by tamoxifen is not estrogen receptor (ER) or sex dependent. Mice treated with ER agonist, 17-β-estradiol did not develop SPEM (A) and neither did estradiol rescue SPEM induced by tamoxifen (right). Similarly, mice treated with ER antagonist, Fulvestrant did not develop SPEM (B) and neither did it rescue SPEM induced by Tamoxifen (right). Ovarectomized (C) and female (right) mice also developed SPEM like their male counterparts (male mice used for all other experiments in the current study) on injection with tamoxifen. D: Raloxifene does not show toxicity, like tamoxifen, at the same dose and time course. E: Cre-recombinase driven by the R26 promoter, in a R26-Reporter background, is induced by Raloxifene. Blue depicts LacZ staining in cells with Cre-recombinase activity. The staining pattern is similar to what we see with tamoxifen in other experiments (not shown) using R26-Cre: nearly all mesenchymal cells and many ZCs show induced recombinase.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplemental Figure 5SPEM induction by tamoxifen is ameliorated by omeprazole treatment. A: Wild-type mice injected with the proton pump inhibitor, omeprazole, in conjunction with tamoxifen (right) are partially protected from SPEM induced by tamoxifen alone (center). Omeprazole, by itself, does not have any effect on the stomach mucosa (left). B: Tamoxifen and omeprazole co-treated mice show higher numbers of H+/K+ ATPase expressing parietal cells (right) when compared to those treated with only tamoxifen (center). Omeprazole alone does not alter the number of H+/K+ ATPase (Atp4) expressing parietal cells (left). These results are quantified in (D). C: Tamoxifen and omeprazole co-treated mice show lower numbers of BrdU positive proliferating cells (right) when compared to those treated with only tamoxifen (center). Omeprazole alone does not alter the number of BrdU positive proliferating cells (left). These results are quantified in (E).View Large Image Figure ViewerDownload Hi-res image Download (PPT)