STAT-1 Interacts with p53 to Enhance DNA Damage-induced Apoptosis

The STAT-1 transcription factor has been implicated as a tumor suppressor by virtue of its ability to inhibit cell growth and promoting apoptosis. However, the mechanisms by which STAT-1 mediates these effects remain unclear. Using human and mouse STAT-1-deficient cells, we show here that STAT-1 is required for optimal DNA damage-induced apoptosis. The basal level of the p53 inhibitor Mdm2 is increased in STAT-1(-/-) cells, suggesting that STAT-1 is a negative regulator of Mdm2 expression. Correspondingly, both basal p53 levels, and those induced by DNA damage were lower in STAT-1(-/-) cells. In agreement with this lower p53 response to DNA damage in cells lacking STAT-1, the induction of p53 responsive genes, such as Bax, Noxa, and Fas, was reduced in STAT-1-deficient cells. Conversely, STAT-1 overexpression enhances transcription of these genes, an effect that is abolished if the p53 response element in their promoters is mutated. Moreover, STAT-1 interacts directly with p53, an association, which is enhanced following DNA damage. Therefore, in addition to negatively regulating Mdm2, STAT-1 also acts as a coactivator for p53. Hence STAT-1 is another member of a growing family of protein partners able to modulate the p53-activated apoptotic pathway. The STAT-1 transcription factor has been implicated as a tumor suppressor by virtue of its ability to inhibit cell growth and promoting apoptosis. However, the mechanisms by which STAT-1 mediates these effects remain unclear. Using human and mouse STAT-1-deficient cells, we show here that STAT-1 is required for optimal DNA damage-induced apoptosis. The basal level of the p53 inhibitor Mdm2 is increased in STAT-1(-/-) cells, suggesting that STAT-1 is a negative regulator of Mdm2 expression. Correspondingly, both basal p53 levels, and those induced by DNA damage were lower in STAT-1(-/-) cells. In agreement with this lower p53 response to DNA damage in cells lacking STAT-1, the induction of p53 responsive genes, such as Bax, Noxa, and Fas, was reduced in STAT-1-deficient cells. Conversely, STAT-1 overexpression enhances transcription of these genes, an effect that is abolished if the p53 response element in their promoters is mutated. Moreover, STAT-1 interacts directly with p53, an association, which is enhanced following DNA damage. Therefore, in addition to negatively regulating Mdm2, STAT-1 also acts as a coactivator for p53. Hence STAT-1 is another member of a growing family of protein partners able to modulate the p53-activated apoptotic pathway. The signal transducer and activator of transcription 1 (STAT-1) 1The abbreviations used are: STAT-1signal transducer and activator of transcription 1MEFmurine embryonic fibroblastsIFN-γinterferon-γDxdoxorubicinCpcisplatinTUNELterminal deoxynucleotidyltransferase-mediated dUTP nick end-labelingGSTglutathione S-transferasePBSphosphate-buffered saline. protein is essential for signaling by interferons (IFNs) (1Stark G.R. Kerr I.A. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3408) Google Scholar), which, in addition to their role in innate immunity, serve as potent inhibitors of growth and promoters of apoptosis. The C-terminal domain of STAT-1 includes a transcriptional transactivation domain, plus two phosphorylation sites, a tyrosine at position 701, which is targeted by Janus kinases (JAKs), and a serine at position 727, which is mitogen-activated protein kinases (MAPKs). STAT-1 dimerization and nuclear relocation depends on tyrosine 701 phosphorylation and that serine 727 phsosphorylation is essential for maximal STAT-1 function (1Stark G.R. Kerr I.A. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3408) Google Scholar). Although STAT-1-deficient mice develop no spontaneous tumors, they are highly susceptible to chemical carcinogen-induced tumorigenesis (2Kaplan D.H. Shankaran V. Dighe A.S. Stoker E. Aguet M. Old L.J. Schreiber R.D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7556-7561Crossref PubMed Scopus (1189) Google Scholar). Crossing the STAT-1 knockout into a p53-deficient background yields animals that develop tumors more rapidly, and with a broader spectrum of tumor types, than is seen with p53 single mutants (2Kaplan D.H. Shankaran V. Dighe A.S. Stoker E. Aguet M. Old L.J. Schreiber R.D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7556-7561Crossref PubMed Scopus (1189) Google Scholar). signal transducer and activator of transcription 1 murine embryonic fibroblasts interferon-γ doxorubicin cisplatin terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling glutathione S-transferase phosphate-buffered saline. Recently STAT-1 has been directly implicated in apoptotic cell death. For example, STAT-1-deficient human U3A fibrosarcoma cells are less susceptible to tumor necrosis factor α-induced cell death than parental cells containing STAT-1 (3Kumar A. Commane M. Flickinger T.W. Horvath C.M. Stark G.R. Science. 1997; 278: 1630-1632Crossref PubMed Scopus (439) Google Scholar). We have also demonstrated that the U3A STAT-1-deficient cells are resistant to hypoxia-induced cell death (4Janjua S. Stephanou A. Latchman D.S. Cell Death Diff. 2002; 9: 1140-1146Crossref PubMed Scopus (27) Google Scholar). STAT-1 also promotes apoptosis in cardiac myocytes exposed to ischemia/reperfusion injury (5Stephanou A. Scarabelli T. Townsend P.A. Bell R. Yellon D.M. Knight R.A. Latchman D.S. FASEB J. 2002; 16: 1841-1843Crossref PubMed Google Scholar, 6Stephanou A. Brar B.K. Scarabelli T. Jonassen A.K. Yellon D.M. Marber M.S. Knight R.A. Latchman D.S. J. Biol. Chem. 2000; 275: 10002-10008Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar, 7Stephanou A. Scarabelli T. Brar B.K. Nakanishi Y. Matsumura M. Knight R.A. Latchman D.S. J. Biol. Chem. 2001; 276: 28340-28347Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar). We showed that STAT-1 serine 727 but not tyrosine 701 phosphorylation is required for the effects of STAT-1 on apoptosis (4Janjua S. Stephanou A. Latchman D.S. Cell Death Diff. 2002; 9: 1140-1146Crossref PubMed Scopus (27) Google Scholar, 5Stephanou A. Scarabelli T. Townsend P.A. Bell R. Yellon D.M. Knight R.A. Latchman D.S. FASEB J. 2002; 16: 1841-1843Crossref PubMed Google Scholar,7Stephanou A. Scarabelli T. Brar B.K. Nakanishi Y. Matsumura M. Knight R.A. Latchman D.S. J. Biol. Chem. 2001; 276: 28340-28347Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar). The requirement for STAT-1 in apoptosis and growth arrest of some cell types may be explained by its ability to up-regulate caspases, Fas, FasL, and the cdk inhibitors p21Waf1 and p27Kip1 (8Agrawal S. Agrawal M.L. Chatterjee-Kishore M. Stark G.R. Chisolm G.M. Mol. Cell Biol. 2002; 22: 1981-1992Crossref PubMed Scopus (83) Google Scholar, 9Lee C-K. Smith E. Gimeno R. Gertner R. Levy D.E. J. Immunol. 2000; 164: 1286-1292Crossref PubMed Scopus (129) Google Scholar, 10Ouchi T. Lee S.M. Ouchi M. Aaronson S.A. Horvath C.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5208-5213Crossref PubMed Scopus (187) Google Scholar). Interestingly, p21Waf1 up-regulation by STAT-1 in mammary cells appears to involve BRCA1, which is often lost in familial and other forms of breast cancer (10Ouchi T. Lee S.M. Ouchi M. Aaronson S.A. Horvath C.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5208-5213Crossref PubMed Scopus (187) Google Scholar). p53 transcriptional activity is stimulated by a variety of genotoxic stimuli. Thus, stabilization of p53 protein levels is regulated by the Mdm2 protein, which interacts with p53 and promotes its degradation by ubiquitination (11Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3790) Google Scholar). The interaction between p53 and Mdm2 is also negatively regulated upstream by p14ARF (human) and p19ARF (mouse) proteins, which bind to Mdm2 and inhibit p53-Mdm2 interaction (12Pomerantz J. Schreiber-Agus N. Liegeois N.J. Silverman A. Alland L. Chin L. Potes J. Chen K. Orlow I. Lee H.W. Cordon-Cardo C. DePinho R.A. Cell. 1998; 92: 713-723Abstract Full Text Full Text PDF PubMed Scopus (1345) Google Scholar). In response to DNA-damaging agents, p53 can either mediate cell cycle arrest or apoptosis. However, the mechanisms determining which of these is induced remains to be fully elucidated. Recently, several proteins, that interact with p53 have been shown to promote the apoptotic function of p53, but not its ability to cause cell cycle arrest. For example ASPP1, a protein homologue of p53BP2, enhances the DNA binding and transactivation function of p53 and promotes its apoptotic role (13Samuels-Lev Y. O'Connor D.J. Bergmaschi D. Trigiante G. Hseih J.K. Zhong S. Campargue I. Naumovski L. Crook T. Lu X. Mol. Cell. 2001; 8: 781-794Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar). In addition, the BRCA1-associated protein BARD1 also interacts with p53 to enhance genotoxic stress-induced apoptosis (14Irminger-Finger I. Leung W.C. Dubois-Dauphin J.M. Harb J. Feki A. Jefford C.E. Soriano J.V. Jaconi M. Montesano R. Krause K.H. Mol. Cell. 2001; 6: 1255-1266Abstract Full Text Full Text PDF Scopus (94) Google Scholar). In contrast, the POU family transcription factor Brn-3a interacts with p53 and inhibits transactivation of the pro-apoptotic Bax gene promoter, while promoting activation of the growth arrest p21 gene promoter (15Buhdram-Mahadeo V.S. Morris P.J. Latchman D.S. Oncogene. 2002; 21: 6123-6131Crossref PubMed Scopus (47) Google Scholar). Thus, p53 interacts with specific protein partners following different stressful stimuli, which may result in p53-dependent transactivation of a number of genes involved in p53-induced apoptosis or growth arrest. There is circumstantial evidence to link p53 and STAT-1 in modulating similar genes. For example, both p53 and STAT-1 activate the p21 gene promoter (16Chin Y.E. Kitagawa M. Su W.C. You Z.H. Iwamoto Y. Fu X.Y. Science. 1996; 272: 719-722Crossref PubMed Scopus (743) Google Scholar, 17Macleod K.F. Sherry N. Hannon G. Beach D. Tokino T. Kinzler K. Vogelstein B. Jacks T. Genes Dev. 1995; 8: 935-944Crossref Scopus (759) Google Scholar). STAT-1, like p53, also interacts with the transcriptional co-activators p300/CREB-binding protein (CBP) at different sites (18Zhang J.J. Vinkemeier U. Gu W. Chakravarti D. Horvath C.M. Darnell Jr., J.E. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15092-15096Crossref PubMed Scopus (424) Google Scholar, 19Lill N.L. Grossman S.R. Ginsberg D. DeCaprio J. Livingston D.M. Nature. 1997; 387: 823-827Crossref PubMed Scopus (602) Google Scholar). p53-CBP interaction results in acetylation of p53, which enhances sequence-specific p53-DNA binding (20Gu W. Roeder R.G. Cell. 1997; 90: 595-606Abstract Full Text Full Text PDF PubMed Scopus (2210) Google Scholar). Hence, STAT-1 and p53 may form a complex with CBP and with other proteins to modulate transcriptional activity of genes in p53-dependent apoptotic signaling pathways. Thus, STAT-1 may regulate the tumor suppression function of p53. Therefore in the present study we have utilized both human cell lines and mouse embryonic fibroblasts deficient in STAT-1 to determine their response to DNA-damaging agents. We show that STAT-1 is required for maximal induction of apoptosis in response to DNA-damaging agents. Interestingly, STAT-1-deficient cells have reduced levels of p53 and enhanced levels of Mdm2, and we show that the in wild-type cells Mdm2 gene promoter is negatively modulated by STAT-1 in response to DNA damage. More significantly, p53 was found to be physically associated with STAT-1 and this protein-protein interaction was enhanced following genotoxic stress. Finally, the induction of pro-apoptotic genes such as Bax, Noxa, and Fas by p53 is enhanced by overexpression of STAT-1, and this is dependent on intact p53 DNA binding sites in their respective promoters. Cell Culture and Reagents—Wild-type STAT-1(+/+) and STAT-1(-/-) mouse embryonic fibroblasts (MEF) were kindly provided by David E. Levy (21Durbin J.E. Hackenmiller R. Simon M.C. Levy D.E. Cell. 1996; 84: 443-450Abstract Full Text Full Text PDF PubMed Scopus (1314) Google Scholar) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Invitrogen). The human fibrosarcoma cell lines 2fTGH and U3A and U3A-derived cells stably expressing STAT-1 were kindly provided by Ian Kerr (22McKendry R. John J. Flavell D. Muller M. Kerr I.A. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11455-11459Crossref PubMed Scopus (233) Google Scholar) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Treatment with cisplatin (Cp, Sigma) and doxorubicin (Dx, Sigma) was performed in subconfluent cultures in 5% fetal bovine serum for the times indicated. Functional Promoter Analysis—Promoter reporter constructs were kindly provided by John Reed (pBax-luciferase), Yoshshinobu Nakanishi (pFas-luciferase), Nobuyuki Tanaka (Wt-pNoxa-Luc and MutpNoxa-Luc), and Frank McCormick (Mdm2-Luc) Expression vectors for STAT-1 and GST-STAT1 constructs were kindly provided by Kurt Horvath. The C-terminal wild-type and mutant STAT-1 constructs were constructed as previously described (5Stephanou A. Scarabelli T. Townsend P.A. Bell R. Yellon D.M. Knight R.A. Latchman D.S. FASEB J. 2002; 16: 1841-1843Crossref PubMed Google Scholar) Transient transfection was performed using the calcium phosphate method. Treatment with cisplatin (10 μm) or doxorubicin (1 μm) for 24 h was performed post-transfection, after which transfected cells were lysed in 100 μl/well of 1× passive lysis buffer (Promega), and 50 μl from each lysate was used to measure firefly and Renilla luciferase activities. Both luciferase assays were quantified using a commercially available kit (Promega) and a TD-20e Luminometer. Values for firefly luciferase were corrected by their corresponding Renilla luciferase values to obtain relative luciferase units (RLU). Band Shift Assays—This was performed as described previously (7Stephanou A. Scarabelli T. Brar B.K. Nakanishi Y. Matsumura M. Knight R.A. Latchman D.S. J. Biol. Chem. 2001; 276: 28340-28347Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar). Briefly nuclear extracts were incubated with either a wild type Noxa DNA probe containing the p53 binding site -174 AGGCTTGCCCCGGCAAGTTG or a mutant (indicated by lowercase) -174 AGGaTTtCCCCGGaAAtTTG (25Oda E. Ohki R. Murasawa H. Nemoto J. Shibue T. Yamashita T. Tokino Taniguchi T. Tanaka N. Science. 2000; 288: 1053-1058Crossref PubMed Scopus (1731) Google Scholar). Samples were also incubated with either a p53 (Oncogene), or STAT-1 or STAT-3 (Santa Cruz Biotechnology) antibody for 30 min prior to incubation with the DNA probe. RT-PCR—RNA was extracted using the standard TRIzol reagent protocol (Invitrogen). Following RT, PCR was carried out with 25 cycles using the following conditions; 94 °C for 40 s, 60 °C for 1 min and 72 °C for 40s. The primer sequences were 5′-CCATGGAGGAGTCACAGTCGG-3′ and 5′-TGTCAGGAGCTCCTGCAGCAC-3′ for p53 and 5′GTTGGAGCGCAAAACGA CACT-3′ and 5′-GTGGCTGTAAGTCAGCAAGAC-3′ for Mdm2 and 5′-CCAGTATGACTCCACTCACGG-3′ and 5′-GGTGCTGAGTATGTCGTGGAG-3′ for GAPDH. Assessment of Apoptosis—After treatment with cisplatin or doxorubicin for 48 h cells were washed twice with ice-cold phosphate-buffered saline (PBS) and fixed in 2% paraformaldehyde for 15 min on ice and washed with PBS. The TUNEL assay (Roche Applied Science) was performed as described by the manufacturer. TUNEL-positive cells were quantified following visual counting using immunofluorescence microscopy. Western Blot Analysis—Cells were treated with cisplatin or doxorubicin for 24 h and cell extracts were prepared in lysis buffer (150 mm NaCl, 50 mm Tris base, 0.5% SDS, 1% Nonidet P-40). Samples were then boiled in SDS sample buffer for 5 min and then run on a 10% SDS-PAGE. Samples were transferred to nitrocellulose filters and subjected to Western blotting using specific antibodies to p53 (Oncogene), p14Arf, and p19Arf (Oncogene), Bax (CN Bioscience), Fas, and STAT-1 (Santa Cruz Biotechnology), phospho-STAT-1 Ser727 (Upstate Technologies) or Tyr701 (Zymed Laboratories Inc.). Immunoprecipitation and GST Pull-down Assays—For detection of STAT-1 and p53 interaction, MEF STAT1 (+/+) cells were either untreated or treated with cisplatin or doxorubicin for 4 h. Cell extracts were prepared in radioimmune precipitation assay buffer (1× PBS, 1% Nonidet P-40, 0.1% SDS, 100 μg/ml phenylmethylsulfonyl fluoride, aprotinin 1 μg/ml), and lysates were incubated with anti-p53 antibody (Oncogene) or control mouse serum and antibody complexes was isolated using protein G-agarose beads (Amersham Biosciences) and washed three times with radioimmune precipitation assay buffer. The beads were then boiled in SDS sample buffer and run on a 10% SDS-PAGE. Samples were transferred to nitrocellulose filters and subjected to Western blotting using anti-STAT-1 antibody (Santa Cruz Biotechnology). GST pull-down assays were performed with the following bacterially expressed GST fusion proteins: GST-STAT-1, encoding a full-length STAT-1 fusion protein; GST-STAT1β, encoding STAT-1 lacking the C-terminal domain; GST-STAT1C, an isolated C-terminal STAT-1 GST fusion protein. Each bacterially expressed GST/STAT-1 fusion protein was incubated with Sepharose beads together with p53 expressed by in vitro translation using the TnT-coupled transcription-translation system as described by the manufacturer (Promega). The Sepharose beads were then washed and subjected to Western blot analysis using antibodies to p53. Immunofluorescence Confocal Microscopy—STAT-1(+/+) or STAT-1(-/-) MEF cells were grown on gelatin-coated coverslips and either left untreated or treated with 50 ng/ml IFN-γ or 10 μm cisplatin for 4 h. After fixation in -20 °C methanol, coverslips were incubated 60 min in 3% bovine serum albumin in PBS at room temperature, followed by incubation in 1% bovine serum albumin in PBS containing 1:200 mouse anti-p53 (CN Bioscience) and 1:200 rabbit anti-STAT-1 (Santa Cruz Biotechnology) for 60 min. After three washes in PBS, 1:2000 Alexa 488 goat anti-mouse (Molecular Probes) and 1:1000 Alexa 568 goat anti-rabbit (Molecular Probes) were added together in 1% bovine serum albumin with Hoechst 33258 (Sigma) for 30 min. After three washes in PBS, coverslips were mounted with DAKO fluorescent mounting medium. Images were collected using a Leica TCS SP2 confocal microscope, and absence of antibody cross-reaction and bleedthrough of fluorophore was verified on control slides. The maximum projection of six cross-sections was taken of each fluorophore individually (as indicated in the figure) and combined (giving yellow where both proteins were present). Statistical Analysis—All results are expressed as the mean ± S.E. of at least three independent experiments. Paired data were evaluated by Student's t test. A one-way analysis of variance was used for multiple comparisons. STAT-1-deficient Cells Are Less Susceptible to DNA Damage-induced Apoptosis—STAT-1-deficient human fibrosarcoma U3A cells were compared with the parental cell line 2fTGH (which contain STAT-1) in their response to DNA damage induced by either cisplatin or doxorubicin. As shown in Fig. 1, although both cisplatin and doxorubicin induced significant apoptosis in the 2fTGH cell line, these responses were reduced significantly in the STAT-1-deficient U3A cells. However, the level of apoptosis following DNA damage was restored to the levels seen in the 2fTGH cells, in the U3A-ST1 cells (U3A cells into which wild-type STAT-1 has been reintroduced by stable transfection). Similar results were also obtained using other methods to assess apoptosis such as propidium iodide staining and Annexin-V-Fluos flow cytometry analysis (data not shown). To exclude the possibility that this was an artifactual result arising from the use of an immortalized cell line, we repeated these studies using MEF STAT1(+/+) and STAT-1(-/-) cell lines. Similar results to those obtained in the 2fTGH/U3A cells were seen in both the MEF STAT1(+/+) and STAT1(-/-) cells in response to either cisplatin or doxorubicin, again showing that STAT-1 is required for maximal apoptosis following exposure to these DNA-damaging agents (Fig. 2). These observations demonstrate that cells lacking STAT-1 are more resistant to apoptosis in response to DNA-damaging agents. STAT-1 Negatively Regulates Mdm2 Expression—DNA damage-induced apoptosis has been shown to be p53-dependent and its stability is regulated by Mdm2 (11Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3790) Google Scholar, 12Pomerantz J. Schreiber-Agus N. Liegeois N.J. Silverman A. Alland L. Chin L. Potes J. Chen K. Orlow I. Lee H.W. Cordon-Cardo C. DePinho R.A. Cell. 1998; 92: 713-723Abstract Full Text Full Text PDF PubMed Scopus (1345) Google Scholar, 23Wu X. Bayle J.H. Olson D. Levine A.J. Genes Dev. 1993; 7: 1126-1132Crossref PubMed Scopus (1665) Google Scholar, 24Vousden K.H. Lu X. Nat. Rev. Cancer. 2002; 8: 594-604Crossref Scopus (2771) Google Scholar). To examine the mechanism by which STAT-1-deficient cells are less sensitive to DNA damage-induced apoptosis, we assessed the expression of p53 and p53-dependent target genes in MEF STAT1(+/+) and STAT1(-/-) cells. Western blot analysis of MEF STAT-1(+/+) and STAT-1(-/-) cells demonstrated that the basal levels of p53 were significantly reduced in MEF STAT-1(-/-) cells compared with STAT-1(+/+) cells (Fig. 3A). Although p53 was induced in both STAT-1(+/+) and STAT-1(-/-) cells in response to DNA damage, the induction of p53 was much lower in the STAT-1(-/-) cells in response to DNA damage (Fig. 3A). RT-PCR analysis demonstrated no significant differences in basal or Dx-induced p53 mRNA levels between STAT1(-/-) and STAT-1(+/+) MEF cells (Fig. 3B). Thus, the basal reduction in p53 protein levels in MEF STAT-1(-/-) cells must be attributed to a difference in p53, possibly, via a post-transcriptional mechanism. p53 stability is known to be regulated by Mdm2 (11Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3790) Google Scholar), which in turn is modulated by p14Arf (human) or p19Arf (mouse) tumor suppressor proteins (12Pomerantz J. Schreiber-Agus N. Liegeois N.J. Silverman A. Alland L. Chin L. Potes J. Chen K. Orlow I. Lee H.W. Cordon-Cardo C. DePinho R.A. Cell. 1998; 92: 713-723Abstract Full Text Full Text PDF PubMed Scopus (1345) Google Scholar). Therefore we analyzed the protein levels of Mdm2 and p19ARF in MEF STAT-1(+/+) and STAT-1(-/-) cells. As shown in Fig. 3, the levels of Mdm2 were significantly higher in STAT1(-/-) cells compared with wild-type cells. In contrast, the levels of p19ARF were similar in both cell types. These data suggest that the reduced expression of p53 in STAT-1(-/-) MEF cells is the result of increased expression of Mdm2, which targets p53 for ubiquitin-mediated proteasome degradation and therefore reduces the sensitivity of these cells to DNA damage-induced apoptosis. We also observed similar reduced Mdm2 expression in the human 2fTGH cells compared with U3A STAT-1-deficient cells (data not shown). To test this further, we compared the levels of p53 and Mdm2 following cisplatin treatment at various time points in wild-type and STAT-1(-/-) MEF cells. As shown in Fig. 3C, the levels of p53 were much greater in the wild-type cells compared with the STAT-1(-/-) MEF cells following cisplatin treatment. Moreover, Mdm2 levels were significantly enhanced in STAT-1(-/-) compared with wild-type MEF cells following cisplatin treatment also in a time-dependent manner (Fig. 3C). These results suggest that the reduced p53 levels in STAT-1(-/-) MEF cells may probably be due to the elevated levels of Mdm2 observed in cells lacking STAT-1 following DNA damage. Thus, STAT-1 may be involved in the negative regulation of the Mdm2 gene resulting in enhanced p53 levels. Therefore, we next examined the mechanism of enhanced expression of Mdm2 in STAT1(-/-) MEF cells by assessing the transcriptional activity of the Mdm2 promoter. Transfection of the Mdm2 reporter construct demonstrated significantly higher basal activity in MEF STAT1(-/-) compared with wild-type cells (Fig. 4A), which also paralleled the protein levels of Mdm2 observed in the above studies. To determine whether STAT-1 regulates the Mdm2 promoter, we next tested whether IFN-γ, which is known to enhance the expression and activity of STAT-1 (1Stark G.R. Kerr I.A. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3408) Google Scholar) is able to reduce the activity of the Mdm2 reporter in STAT1(+/+) cells. As shown in Fig. 4A, IFN-γ alone was able to inhibit Mdm2 promoter activity in STAT1(+/+) cells but not in STAT1(-/-) MEF cells. p53 is known to activate the Mdm2 promoter and therefore modulates its own stability (22McKendry R. John J. Flavell D. Muller M. Kerr I.A. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11455-11459Crossref PubMed Scopus (233) Google Scholar, 23Wu X. Bayle J.H. Olson D. Levine A.J. Genes Dev. 1993; 7: 1126-1132Crossref PubMed Scopus (1665) Google Scholar). Therefore we also examined whether IFN-γ/STAT-1 activation is also able to inhibit doxorubicin-induced p53 enhancement of Mdm2 promoter activity. As shown in Fig. 4A, doxorubicin enhanced Mdm2 reporter activity in both STAT1(+/+) and in STAT1(-/-) MEF cells. However, IFN-γ reduced doxorubicin-induced Mdm2 promoter activity in STAT1(+/+) and to a less extent in STAT-1(-/-) MEF cells. Fig. 4B illustrates that the endogenous levels of Mdm2 correlated with the activity of the Mdm2 promoter following treatment with either IFN-γ or doxorubicin alone or in combination. Thus, IFN-γ enhanced STAT-1 levels and reduced Mdm2 levels in STAT-1(+/+) MEF cells but not in STAT-1(-/-) MEF cells. Furthermore, doxorubicin-mediated enhancement of Mdm2 levels was also inhibited by IFN-γ in STAT-1(+/+) MEF cells and also to an extent in STAT1(-/-) MEF cells. We also have observed in our transient transfection experiment that overexpression of STAT-1 can also inhibit p53- up-regulation of Mdm2 promoter activity (data not shown). Thus, these data strongly show that IFN-γ, by activating STAT-1, is able to reduce the constitutive activity of the Mdm2 promoter and also reduce the stimulatory effects of p53 on Mdm2 promoter activity. However, IFN-γ signaling pathway is also able to inhibit DNA-damage p53-mediated induction of the Mdm2 promoter and protein levels in the STAT-1(+/+) and STAT-1(-/-) MEFs (Fig. 4, A and B). To confirm whether the observed changes in the Mdm2 promoter activity were also occurring at the mRNA levels following the treatments as shown in Fig. 4A, we measured Mdm2 mRNA levels by RT-PCR. As shown in Fig. 4C, IFN-γ reduced Mdm2 mRNA levels in wild-type but not in STAT-1(-/-) MEF cells. Moreover, IFN-γ also reduced doxorubicin-induced Mdm2 mRNA expression in wild-type but not in STAT-1(-/-) MEF cells. Thus, STAT-1 activation via IFN-γ exposure also inhibits Mdm2 expression at the mRNA level. Optimal Expression of Pro-apoptotic Genes Requires STAT-1 in Response to DNA Damage—We next examined the levels of p53 target genes that are known to stimulate apoptotic cell death. Western blot analysis demonstrated enhanced Bax, and Fas expression in STAT1(+/+) cells in response to DNA damage compared with STAT1(-/-) cells (Fig. 5A). Thus, in the absence of STAT-1, the induction of these pro-apoptotic factors is reduced. Bax, Noxa, and Fas promoter constructs were used to determine whether the alteration observed in protein levels was due to a direct effect at the transcriptional level. Transfection of these reporter constructs into STAT1(+/+) and STAT1(-/-) MEF cells showed that promoter activity was enhanced more efficiently in response to doxorubicin-induced DNA damage in wild-type cells compared with STAT1(-/-) cells (Fig. 5B). To determine whether p53 is required for STAT-1-mediated enhancement of p53 target genes, we examined the activity of the Noxa reporter in the p53-deficient Soas-2 cell line. Interestingly, we observed that overexpression of STAT-1 had no significant effect on Noxa promoter activity in the absence of p53 (Fig. 6A). However, re-introduction of p53 by transfection using a p53 expression vector in Soas-2 cells increased Noxa promoter activity. Overexpression of p53 together with STAT-1 enhanced Noxa promoter activity even further than transfection of p53 alone (Fig. 6A). Similarly, in the STAT1(-/-) MEF cells, where overexpression of p53 resulted in a small increase in Noxa promoter activity, overexpression of STAT-1 together with p53, resulted in a further enhanced Noxa promoter activity (Fig. 6B). Similar results were also obtained using the Bax and Fas reporter constructs (data not shown). To demonstrate that these effects are mediated via the p53 DNA binding site, we next examined a Noxa reporter construct, in which the p53 DNA binding site was mutated to remove p53 responsiveness, as previously reported (25Oda E. Ohki R. Murasawa H. Nemoto J. Shibue T. Yamashita T. Tokino Taniguchi T. Tanaka N. Science. 2000; 288: 1053-1058Crossref PubMed Scopus (1731) Google Scholar). Mutation of the p53 binding site in this promoter resulted in a significant reduction in reporter activity compared with wild-type Noxa promoter activity in STAT1(+/+) cells overexpressing STAT-1 or p53 (Fig. 6C). Once again, overexpression of STAT-1 together with p53 was able to enhance the activity of the Noxa wild-type promoter, but had no effect on a mutant Noxa promoter. These results demonstrate that STAT-1 is able to modulate p53 transcriptional activity, possibly by enhancing p53 binding to DNA. We next examined whether the observed effects of S