The Oncogenic Fusion Protein-tyrosine Kinase ZNF198/Fibroblast Growth Factor Receptor-1 Has Signaling Function Comparable with Interleukin-6 Cytokine Receptors

The reciprocal t(8;13) chromosome translocation results in a fusion gene (FUS) in which the N-terminal half of the zinc finger protein ZNF198 is combined with the cytoplasmic domain of the fibroblast growth factor receptor-1 (FGFR1). Expression of FUS is suggested to provide growth-promoting activity to myeloid cells similar to the activity of hematopoietic cytokine receptors. This study determined the specificity of FUS to activate signal transduction pathways. Because no tumor cell line expressing FUS was available, the mode of FUS action was identified in cells transiently and stably transfected with an expression vector for FUS. FUS acted as a constitutively active protein-tyrosine kinase and mediated phosphorylation of STAT1, 3, and 5 but not STAT4 and 6. The same specificity but lower activity was determined for normal FGFR1. STAT activation by FUS, similar to that by interleukin-6-type cytokines, promoted STAT-specific induction of genes. The functionality of FUS, as well as the relative recruitment of STAT isoforms, was determined by the dimerizing function of the zinc finger domain. Replacement of the ZNF198 portion by the Bcr portion as present in the t(8;22) translocation shifted the signaling toward a more prominent STAT5 activation. This study documents that both gene partners forming the fusion oncogene define the activity and the signaling specificity of the protein-tyrosine kinase of FGFR1. The reciprocal t(8;13) chromosome translocation results in a fusion gene (FUS) in which the N-terminal half of the zinc finger protein ZNF198 is combined with the cytoplasmic domain of the fibroblast growth factor receptor-1 (FGFR1). Expression of FUS is suggested to provide growth-promoting activity to myeloid cells similar to the activity of hematopoietic cytokine receptors. This study determined the specificity of FUS to activate signal transduction pathways. Because no tumor cell line expressing FUS was available, the mode of FUS action was identified in cells transiently and stably transfected with an expression vector for FUS. FUS acted as a constitutively active protein-tyrosine kinase and mediated phosphorylation of STAT1, 3, and 5 but not STAT4 and 6. The same specificity but lower activity was determined for normal FGFR1. STAT activation by FUS, similar to that by interleukin-6-type cytokines, promoted STAT-specific induction of genes. The functionality of FUS, as well as the relative recruitment of STAT isoforms, was determined by the dimerizing function of the zinc finger domain. Replacement of the ZNF198 portion by the Bcr portion as present in the t(8;22) translocation shifted the signaling toward a more prominent STAT5 activation. This study documents that both gene partners forming the fusion oncogene define the activity and the signaling specificity of the protein-tyrosine kinase of FGFR1. myeloid proliferative disease chloramphenicol acetyl transferase fibroblast growth factor fibroblast growth factor receptor-1 green fluorescent protein interleukin leukemia inhibitory factor oncostatin M proline-rich domain suppressor of cytokine signal signal transducers and activators of transcription zinc finger protein 198 extracellular signal-regulated kinase fast protein liquid chromatography epidermal growth factor EGF receptor Reciprocal chromosomal translocations in specific types of leukemia have consistently led to the isolation of genes important for the oncogenic process (1Rabbitts T.H. Science. 1994; 372: 143-149Google Scholar). An atypical chronic form of myeloproliferative disease (MPD)1 was described some years ago (2Abruzzo L.V. Jaffe E.S. Cotelingam J.D. Whang-Peng J. Del Duca V. Medeiros L.J. Am. J. Surg. Pathol. 1992; 16: 236-245Crossref PubMed Scopus (105) Google Scholar) that is associated with T-cell leukemia/lymphoma and peripheral blood eosinophilia. Cytogenetic analysis of bone marrow aspirated from these patients showed a consistent reciprocal chromosome translocation t(8;13)(p11;q12). In some cases this rearrangement was the only cytogenetic abnormality. In our initial studies we identified the position of the translocation breakpoints using fluorescentin situ hybridization (3Kempski H. MacDonald D. Michalski A.J. Roberts T. Goldman J.M. Cross C.P. Cowell J.K. Cancer. 1995; 12: 283-287Google Scholar) and then used somatic cell hybrids to clearly define the location of the breakpoints on both chromosomes (4Still I.H. Chernova O. Hurd D. Stone R.M. Cowell J.K. Blood. 1997; 90: 3136-3141Crossref PubMed Google Scholar, 5Chernova O. Still I.H. Kalaycio M. Hoeltge G. Cowell J.K. Genes Chromosomes Cancer. 1997; 21: 160-165Crossref Scopus (11) Google Scholar). The 8p11 translocation breakpoint was subsequently shown to interrupt the FGFR1 gene, and in all of the patients reported so far, these breakpoints cluster within intron 8. The chromosome breakpoint in 13q12 was reported by several groups to involve a zinc finger-containing gene, ZNF198 (also called RAMP8 and FIM), where the breakpoint is consistently located in intron 17. Despite some discrepancies in early reports (6Smedley D. Hamoudi R. Clark J. Warren W. Abdul-Rauf M. Somers G. Venter D. Fagan K. Cooper C. Shipley J. Hum. Mol. Genet. 1998; 7: 637-642Crossref PubMed Scopus (100) Google Scholar, 7Xiao S. Nalabolu S.R. Aster J.C. Ma J. Abruzzo L. Jaffe E.S. Stone R. Weissman S.M. Hudson T.J. Fletcher J.A. Nat. Genet. 1998; 18: 84-87Crossref PubMed Scopus (282) Google Scholar), the full-length structure of the ZNF198 gene and the nature of the fusion gene were resolved (8Still I.H. Cowell J.K. Blood. 1998; 92: 1456-1458Crossref PubMed Google Scholar, 9Popovici C. Adelaide J. Ollendorff V. Chaffenet M. Guasch G. Jacrot M. Leroux D. Birnbaum D. Pebusque M.-J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5712-5717Crossref PubMed Scopus (131) Google Scholar), which demonstrated that the chimeric gene resulted from an in-frame fusion of the ZNF198 zinc finger motif and proline-rich domain (PRD) with the intracellular domain containing the tyrosine kinase region of FGFR1. ZNF198 is a widely expressed gene and is predicted to encode a 1377-amino acid nuclear protein with a molecular mass of 155 kDa (7Xiao S. Nalabolu S.R. Aster J.C. Ma J. Abruzzo L. Jaffe E.S. Stone R. Weissman S.M. Hudson T.J. Fletcher J.A. Nat. Genet. 1998; 18: 84-87Crossref PubMed Scopus (282) Google Scholar, 8Still I.H. Cowell J.K. Blood. 1998; 92: 1456-1458Crossref PubMed Google Scholar, 9Popovici C. Adelaide J. Ollendorff V. Chaffenet M. Guasch G. Jacrot M. Leroux D. Birnbaum D. Pebusque M.-J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5712-5717Crossref PubMed Scopus (131) Google Scholar, 10Kulkarni S. Reiter A. Smedley D. Goldman J.M. Cross N.C Genomics. 1999; 55: 118-121Crossref PubMed Scopus (21) Google Scholar). Prominent features of ZNF198 are the five zinc finger motifs and a PRD within the central portion of the protein and an acidic domain at the C-terminal end of the protein. The zinc finger motif is unusual in that its structure is characteristic of protein-protein interactions rather than a transcription factor. Despite these motifs, the function of this protein is unknown. FGFR1 is a transmembrane receptor protein-tyrosine kinase belonging to the fibroblast growth factor receptor family (11Powers C.J. McLeskey S.W. Wellstein A. Cancer. 2000; 7: 165-197Google Scholar). Through fusion of the cytoplasmic kinase domain to the ZNF198, the resulting chimeric protein, ZNF198/FGFR1 (hereafter termed FUS) is assumed to exert signaling functions accounting for the oncogenic event in myeloid cells (12Macdonald D. Reiter A. Cross N.C. Acta Haematol. 2002; 107: 101-107Crossref PubMed Scopus (195) Google Scholar). Stable expression of FUS in Ba/F3 cells confirmed the growth-promoting activity by providing the cells with IL-3-independent survival (13Ollendorff V. Guasch G. Isnardon D. Galindo R. Birnbaum D. Pebusque M.J. J. Biol. Chem. 1999; 274: 26922-26930Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) or even proliferation (14Xiao S. McCarthy J.G. Aster J.C. Fletcher J.A. Blood. 2000; 96: 699-704Crossref PubMed Google Scholar). The same cells indicated an elevated signaling that included the phosphatidylinositol 3-kinase and p38 mitogen-activated protein kinase pathways (14Xiao S. McCarthy J.G. Aster J.C. Fletcher J.A. Blood. 2000; 96: 699-704Crossref PubMed Google Scholar, 15Demiroglu A. Steer E.J. Heath C. Taylor K. Bentley M. Allen S.L. Koduru P. Brody J.P. Hawson G. Rodwell R. Doody M.L. Carnicero F. Reiter A. Goldman J.M. Melo J.V. Cross N.C. Blood. 2001; 98: 3778-3783Crossref PubMed Scopus (180) Google Scholar). The signaling specificity of the fusion kinase has been proposed based on the known function of FGFR1 (11Powers C.J. McLeskey S.W. Wellstein A. Cancer. 2000; 7: 165-197Google Scholar, 16Klint P. Claesson-Welsh L. Front. Biosci. 1999; 4: 165-177Crossref PubMed Google Scholar). However, the type of signaling could not be accurately predicted because the ligand-activated FGFR1 functions at the plasma membrane, whereas the fusion kinase acts as a cytoplasmic and, to some extent, nuclear protein. The analysis of another fusion kinase that contains the cytoplasmic domain of FGFR1, FOP/FGFR1, demonstrated the capability of the kinase to act in Ba/F3 cells via pathways that include STAT1 and STAT3, ERK, and phosphatidylinositol 3-kinase/Akt (17Guasch G. Ollendorf F, V. Borg J.P. Birnbaum D. Pebusque M.J. Mol. Cell. Biol. 2001; 21: 8129-8142Crossref PubMed Scopus (66) Google Scholar). The constitutive activity of FGFR1 kinase, whether as part of ZNF198/FGFR1, FOP/FGFR1, or Bcr/FGFR1, has been attributed to the oligomerizing activity provided by each of the N-terminal fusion partners (9Popovici C. Adelaide J. Ollendorff V. Chaffenet M. Guasch G. Jacrot M. Leroux D. Birnbaum D. Pebusque M.-J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5712-5717Crossref PubMed Scopus (131) Google Scholar, 13Ollendorff V. Guasch G. Isnardon D. Galindo R. Birnbaum D. Pebusque M.J. J. Biol. Chem. 1999; 274: 26922-26930Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 15Demiroglu A. Steer E.J. Heath C. Taylor K. Bentley M. Allen S.L. Koduru P. Brody J.P. Hawson G. Rodwell R. Doody M.L. Carnicero F. Reiter A. Goldman J.M. Melo J.V. Cross N.C. Blood. 2001; 98: 3778-3783Crossref PubMed Scopus (180) Google Scholar, 18Fioretos T. Panagopoulos I. Lassen C. Swedin A. Billstrom R. Isaksson M. Strombeck B. Olofsson T. Mitelman F. Johansson B. Genes Chromosomes Cancer. 2001; 32: 302-310Crossref PubMed Scopus (94) Google Scholar) Because the expression of ZNF198/FGFR1 in Ba/F3 cells displayed some of the properties associated with the action of hematopoietic cytokine receptors, we investigated the range of signaling that is executed by the fusion kinase and whether this signaling is identifiable by the specificity of transcriptional regulation of cytokine-responsive genes. By using various experimental cell models we have identified a signaling capacity that is comparable with that of IL-6 cytokines. The various expression vectors for constructs containing ZNF198 and FGFR1 sequences are described in Fig. 1. The full-length ZNF198 cDNA was amplified from a fetal bone marrow cDNA library (Clontech), and ZNF198/FGFR1 (FUS) cDNA was amplified from a patient RNA sample (4Still I.H. Chernova O. Hurd D. Stone R.M. Cowell J.K. Blood. 1997; 90: 3136-3141Crossref PubMed Google Scholar). The cDNAs were inserted into the pcDNA3 vector. The ATG codon from each of these constructs was modified to ATCC and then cloned into the pEGFPc2 vector using BglII/SalI sites yielding GFP-ZNF198 and GFP-FUS, respectively (19Kanapuli P Somerville R.T.P. Still I.H. Cowell J.K. Oncogene. 2003; (in press)Google Scholar). The full-length FGFR1 gene was amplified from HEK 293 cDNA using a BamHI-modified FGFR1 forward primer (AAAGGATCCATGTGGAGCTGGAAGTGCC) and aNotI-modified FGFR1 reverse primer (ATTTGATAGCGGCCGCTCAGCGGCGTTTGAGTCC) and then cloned into theBamHI/NotI sites of pcDNA3. To generate GFP-FUS lacking the PRD, GFP-FUS(ΔPRD), the ZNF198-ΔPRD portion was amplified by using the KpnI/ZNF198 forward primer (CGGGGTACCCCGATCCTGGCAGGAGACGTTTTT) and the XbaI/ZNF198 reverse primer (TGCTCTAGAGCAGTCATTTTGGTTCGAGATGTCTG). The FGFR1 portion was amplified using the XbaI/FGFR1 forward primer (TGCTCTAGAGCAGTGTCTGCTGACTCCAGTGCATCCATGAAC) and theBamHI/FGFR1 reverse primer (CGCGGATCCGCGTCAGCGGCGTTTGAGTCCGCCATTGG) and cloned into theKpnI/BamHI sites of the pEGFPc2 vector. FUS lacking exons 7–17 (Δ7–17), thus devoid of the distal four zinc fingers and the PRD, was derived by the in-frame fusion of ZNF198 exons 1–7 with FGFR1 exons 9–17 using NheI-modified primers. The C-terminally truncated ZNF198 gene, ZF1, which represents the portion of ZNF198 that is present in FUS, was generated using forward (ATGGACACAAGTTCAGTGGGA) and reverse primers (CCTTTTTTTTAGATCGAGGTCTG) and cloned into the pcDNA3.1 GFP-CT TOPO vector (Invitrogen). The Bcr/FGFR1 chimeric kinase, as described by Demiroglu et al. (15Demiroglu A. Steer E.J. Heath C. Taylor K. Bentley M. Allen S.L. Koduru P. Brody J.P. Hawson G. Rodwell R. Doody M.L. Carnicero F. Reiter A. Goldman J.M. Melo J.V. Cross N.C. Blood. 2001; 98: 3778-3783Crossref PubMed Scopus (180) Google Scholar), was generated using theKpnI Bcr1 forward primer (GGGGTACCCCATGGTGGACCCGGTGGGCTTCGCGGAGGCG) and the XbaI BcR1 reverse primer (TGCTCTAGAGCAAATATTCAGCTTCTGGAAGAGGTCGCC) in combination with the XbaI FGFR1 forward primer (TGCTCTAGAGCAGTGTCTGCTGACTCCAGTGCATCCATG) and the NotI FGFR1 reverse primer (ATAAGAATGCGGCCGACTAAACTATTCAGCGGCGTTTGAGT). The PCR products were digested with the respective enzymes and inserted into the pcDNA3 expression vector. All of the constructs were verified by sequencing. The expression vectors used for the following proteins were: v-Src in the pDC vector (20Wang Y. Ripperger J. Fey G.H. Samols D. Kordula T. Wetzler M. Van Etten R.A. Baumann H. Hepatology. 1999; 30: 682-697Crossref PubMed Scopus (46) Google Scholar); p190Bcr/Abl (5.2-kb EcoRI fragment of pGDp190Bcr/Abl) and p210Bcr/Abl (6.7-kb EcoRI fragment of pGDp210Bcr/Abl) (21Daley G.Q. Van Etten R.A. Baltimore D. Science. 1990; 247: 824-830Crossref PubMed Scopus (1929) Google Scholar) subcloned into pSV-Sport1, v-FMS (22Wheeler E.F. Roussel M.F. Hampe A. Walker M.H. Fried V.A. Look A.T. Rettenmier C.W. Sherr C.J. J. Virol. 1986; 59: 224-233Crossref PubMed Google Scholar), and v-Abl (23Scott M.L. Van Etten R.A. Daley G.Q. Baltimore D. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6506-6510Crossref PubMed Scopus (36) Google Scholar) in the pGD vector (provided by Richard Van Etten, The Center for Blood Research, Harvard Medical School, Boston, MA); SOCS1 and SOCS3 in the pcDNA1 vector; and STAT1, STAT3, STAT4, STAT5B, and STAT6 in the pDC vector (24Lai C.F. Ripperger J. Morella K.K. Wang Y. Gearing D.P. Fey G.H. Baumann H. J. Biol. Chem. 1995; 270: 14847-14850Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 25Lai C.F. Ripperger J. Wang Y. Kim H. Hawley R.B. Baumann H. J. Biol. Chem. 1999; 274: 7793-7798Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). The following reporter gene constructs were applied: the STAT5-sensitive p(8xHRRE)-CAT, the STAT3-sensitive p(5xHPX-IL-6RE)-CAT, and the cytokine-, growth factor-, and glucocorticoid receptor-sensitive p(3xCytRE)-GRE-AGP-CAT (26Morella K.K. Lai C.F. Kumaki S. Kumaki S. Wang Y. Bluman E.M. Witthuhn B. Ihle J.N. Giri J. Gearing D.P. Cosman D. Ziegler S.F. Tweardy D.J. Campos S.P. Baumann H. J. Biol. Chem. 1995; 270: 8298-8310Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar). Human hepatoma HepG2, breast carcinoma MCF7, 293, and COS-7 cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum and antibiotics. HepG2 and 293 cells were transfected using the calcium phosphate precipitation technique (20Wang Y. Ripperger J. Fey G.H. Samols D. Kordula T. Wetzler M. Van Etten R.A. Baumann H. Hepatology. 1999; 30: 682-697Crossref PubMed Scopus (46) Google Scholar, 27O'Mahoney J.V. Adams T.E. DNA Cell Biol. 1994; 13: 1227-1232Crossref PubMed Scopus (82) Google Scholar) and MCF7 and COS-7 cells with FuGENE 6 (Roche Molecular Biochemicals). Transfection efficiency was assessed by co-transfection with the expression vector for either GFP or red fluorescent protein (Clontech) and quantified by digital florescent image analysis as described previously (20Wang Y. Ripperger J. Fey G.H. Samols D. Kordula T. Wetzler M. Van Etten R.A. Baumann H. Hepatology. 1999; 30: 682-697Crossref PubMed Scopus (46) Google Scholar). To determine signaling function, transfected cultures were subdivided and seeded into 24-well culture plates. After a 24-h recovery period, the cells were treated with cytokines (generally 100 ng/ml), basic FGF (R & D; 10 ng/ml in the presence of 100 units of heparin), or kinase inhibitor as indicated in the legend to the appropriate figures. Depending on whether the signal initiation by cytokines or the induction of CAT reporter genes was being analyzed, the length of treatment ranged from 15 min to 24 h. For immunoblot analysis, the cells were extracted within the culture wells with RIPA buffer (50 μl/cm2 monolayer). CAT activity was determined in serially diluted cell extracts and normalized as described previously (20Wang Y. Ripperger J. Fey G.H. Samols D. Kordula T. Wetzler M. Van Etten R.A. Baumann H. Hepatology. 1999; 30: 682-697Crossref PubMed Scopus (46) Google Scholar). 293 cells stably expressing GFP-FUS, FUS, FGFR1, or GFP were generated by transfecting the cells with the expression vector for these proteins. Transfectants were selected by culturing in the presence of 1 mg/ml G-418 for 3–5 weeks (two to four passages). The resulting cultures of proliferating cells were considered “pools” of stably transfected 293 cells. Subclonal lines were established using the limited dilution technique. Identification of protein-expressing cell cultures and clones relied on detection of the proteins and tyrosine phosphorylation by immunoblotting and GFP fluorescence, where applicable. The stability of transgene expression in the individual clones were tested by additional rounds of subcloning. Aliquots of whole cell lysates (10–30 μg of protein) were separated on 6–12% SDS-polyacrylamide gels. The proteins were transferred to protean membranes (Schleicher & Schuell). Wherever possible, replicates of the sample series were electrophoresed on separate gels for identification of multiple antigens (29Ong S.H. Hadari Y.R. Gotoh N. Guy G.R. Schlessinger J. Lax I. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6074-6079Crossref PubMed Scopus (263) Google Scholar). This approach circumvented the problem of incomplete removal of antibodies during the process of sequential immunoblotting of the same membrane. The membranes were reacted with antibodies to STAT1, STAT3, STAT4, STAT5, STAT6, ERK1, ERK2, the C-terminal epitope of FGFR1 (Santa Cruz Biotechnology), PY-STAT3, PY-STAT5, P-ERK (New England Biolabs, Inc.), GFP (Covance Babco), or the N-terminal half of ZNF198 (19Kanapuli P Somerville R.T.P. Still I.H. Cowell J.K. Oncogene. 2003; (in press)Google Scholar) and followed with secondary antibodies (ICN Biomedicals, Inc., Aurora, OH) in phosphate-buffered saline containing 0.1% Tween, 5% milk, or 3% bovine serum albumin. The immunoreactions were visualized using enhanced chemiluminescene according to the manufacturer's instructions (Amersham Biosciences). Different time exposures (seconds to 30 min) of x-ray film (XAR-5, Kodak) to the luminescent patterns were made for optimal detection of quantitative signal differences. Digital densitometry of the patterns were analyzed with the ImageQuant program (Molecular Dynamics). MCF7 cells (1 × 107 in a 15-cm-diameter culture dish) were transfected with GFP-ZNF198, FUS, GFP-FUS, or FUS(Δ7–17). After 36 h, the cells were washed with Tris-buffered saline, scraped, and collected by centrifugation. The cell pellet was resuspended on ice in 300 μl of extraction buffer (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 10% glycerol, 1% Nonidet P-40, 1 mmNa2VO4, 1 mm phenylmethylsulfonyl fluoride, 1 mm EGTA, 1 μg/ml of each, aprotinin, and leupeptin) and disrupted by sonication for 3 s. The cell extract was cleared by ultracentrifugation for 60 min at 100,000 ×g. A 200-μl aliquot of the supernatant extract was directly applied onto a Superose 12 column and separated by FPLC (Pharmacia Corp.) in extraction buffer at a flow rate of 0.4 ml/min. Eluant was collected in 0.2-ml fractions. Aliquots of 5 μl from these fractions were analyzed by Western blotting for FGFR, ZNF198, GFP, and phosphotyrosine. Purified thyroglobulin, monomeric and dimeric bovine serum albumin, and chymotrypsinogen were used to size calibrate the chromatographic separation. The expression vector containing the cDNAs encoding ZNF198, FUS (ZNF198/FGFR1), and FGFR1, as shown in Fig. 1, were transfected into MCF7 cells to determine their expression levels and to verify that the correct sized proteins were produced. The Western blot assays confirmed the immune detectable presence of the ZNF198 (Fig.2 A) and the FGFR1 epitopes (Fig. 2 B) in bands corresponding to the expected full-length proteins. Strong expression was seen for the 155-kDa FUS, the 172-kDa GFP-tagged FUS, and 177-kDa GFP-tagged ZNF198. Expression of FUS(Δ7–17) protein, lacking most of the zinc finger motif, was also detected, but at a relatively low level. Of note is that the turnover of the untagged, but not the GFP-tagged, FUS protein led to the accumulation of a stable breakdown product of ∼40 kDa that contained the FGFR1 epitope (Fig. 2 B, ΔFUS). The relative amount and the molecular size of the degradation product detectable in the transfected cells were dependent on the cell line. Among the cell lines tested in this study, the degradation product was most abundant in MCF7 cells and lowest in 293 cells (see Fig. 11). When the same cell extracts were probed with an antiphosphotyrosine (anti-PY) antibody, the full-length constructs containing the FGFR1 kinase domain were phosphorylated (Fig. 2 C). The comparison of immunoblot signals for FGFR1 and phosphotyrosine indicated that both the untagged and GFP-tagged FUS were highly phosphorylated. In contrast, the tyrosine phosphorylation of the overexpressed FGFR1 and FUS(Δ7–17) was low, and no phosphorylation was detectable for ZNF198. The relative expression of the transfected vectors and relative level of phosphorylation of the different proteins, as seen in MCF7 (Fig. 2), were also observed in other cells lines (see below), ruling out appreciable cell type-specific effects on expression and action of these proteins.Figure 11Difference in signaling by FUS and Bcr/FGFR1. A, 293 cells were transfected with a decreasing dose of the expression vector for FUS or Bcr/FGFR1 (4–0.04 μg/well). The cell extracts of the cells 36 h after transfection were analyzed by immunoblotting for the level of proteins detectable with anti-FGFR1 or anti-phosphotyrosine (PY). The positions of the full-length FUS and Bcr/FGFR1 are indicated. The position of the ∼65-kDa fragment of FUS (ΔFUS) is given on theleft. B, the extracts from the cells transfected with 4 μg of the expression vector in A were analyzed for the level of the signaling proteins listed at the right. Note, the antibodies against the tyrosine-phosphorylated STAT proteins also cross-react with the kinases. C, HepG2 cells were transfected with the CAT reporter constructs (15 μg/ml), p(8xHRRE)-CAT (left panel), or p(5xHPX-IL-6RE)-CAT (right panel) and decreasing amount of expression vectors carrying FUS, Bcr/FGFR1, or FGFR1 (from 5 to 0.02 μg/ml). The expression of the reporter genes relative to the untreated vector control is presented (mean ± S.D. of three separate experiments).W.B., Western blotting.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The detailed morphology of adherent MCF7 and HepG2 cells facilitated the visualization of the subcellular localization of the transfected proteins (Fig. 3). GFP-ZNF198 was localized in both cell types primarily to the nucleus with higher concentrations in distinct subnuclear structures, including PML bodies. This pattern did not alter during the extended period of culturing. In contrast, GFP-FUS revealed a temporal change in distribution. During the first 12–24 h the FUS appeared to be predominantly cytoplasmic. During the subsequent culture period, GFP-FUS became more broadly distributed within the cells, with local accumulation at numerous sites within the cytoplasm. These accumulations gave the cells a “spotty” appearance (Fig. 3, GFP-FUS, 36 h). At later time points, there was also a detectable staining of the nucleus. The subcellular distribution of GFP-FUS and GFP-ZNF198 is distinct from that of GFP (Fig. 3, GFP). GFP showed the uniform cytoplasmic and nuclear distribution. A virtually identical subcellular distribution as seen for the transfected ZNF198 and FUS was observed with other cell types, including COS-7, NIH3T3 (data not presented), and 293 cells (Fig. 4 B and Ref. 13Ollendorff V. Guasch G. Isnardon D. Galindo R. Birnbaum D. Pebusque M.J. J. Biol. Chem. 1999; 274: 26922-26930Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar).Figure 4Generation of 293 cells stably expressing GFP-FUS, FUS, FGFR1, or GFP. Cultures of 293 cells were transfected with the expression vector for GFP-FUS, FUS, FGFR1, or GFP. Stable integrants (Pools) were selected by proliferation in G-418. Clonal lines of GFP-FUS positive cells (Clones 1–12) were isolated and subjected to a second round of subcloning to confirm the homogeneity of the expression pattern. A, cell extracts from the parental 293 cells and clones 1 and 8 of GFP-FUS were analyzed by Western blotting (WB) for immune detectable phosphotyrosine (PY) and GFP epitopes. The position of the full-length GFP-FUS is indicated. B, a phase and fluorescent image of the culture of GFP-FUS 293 cells, clone 8, was taken at 20× magnification (left two panels) and is compared with the fluorescent image of 293 GFP pool cells (right panel).C, the culture morphology of parental 293 cells, GFP-FUS clones 1 and 8, 293 FUS pool, and 293 FGFR1 pool, is recorded by phase microscopy at 10× magnification.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To assess the effects of FUS on proliferation and cellular phenotype, we established 293 cell lines stably expressing FUS. During these experiments, several important aspects about the ability of cells to support expression of FUS became evident. Although cells, which were initially selected for resistance to G-418, showed prominent FUS and GFP-FUS expression as detectable by immunoblotting and, in the latter case, by fluorescent microscopy, with serial passage of the pool cultures, the percentage of FUS-expressing and GFP-positive cells in the population declined. In contrast, 293 cells transfected with the expression vector for GFP, GFP-ZNF198, or FGFR1 and selected for G-418 resistance maintained long term protein expression. This observation suggested that the expression of the active FUS kinase interfered with growth selection. The difficulty in isolating stable clonal lines was best illustrated by following the visual expression of GFP-FUS. Generally, the intensely green fluorescent cells present after transfection lost adhesion to the culture substratum and either apoptosed or, in a few instances (∼1 × 10−3 of the GFP-positive cells), formed slowly growing spheres. From this we concluded that high level expression of FUS was cytotoxic and thus prevented the recovery of stable lines with high expression levels. Among the cells that maintained adherence, more than 90% of the clonal lines generated from these cells demonstrated unstable phenotypes. The expression of FUS was heterogeneous, with frequent occurrence of GFP-FUS proteins being truncated to forms ranging in size from 28 to 60 kDa. In all of those cells, the subcellular distribution of GFP changed to an evenly distributed pattern, the same distribution observed in cells expressing normal GFP, as shown in Fig. 4 B (right panel). On a few occasions, however, we were able to recover truly stable subclonal lines that expressed the full-length fusion kinase in all cells (Fig. 4, A and B, left panels). From the initially transfected culture of 1 × 106cells, we succeeded in establishing 12 individual subclonal lines expressing full-length GFP-FUS (numbered 1–12). Our attempt to isolate stable lines expressing untagged FUS by sequential screening of clones for kinase expression by immunoblotting proved to be nonproductive. Although we could determine expression of FUS in pool and few initial clones, the FUS expression in these cells proved to be instable and, without the benefit of a vital marker, we were unable to recover the stable subclonal line. The GFP-FUS cell lines differ in their level of kinase expression with the highest level recorded for Clone 1 and lowest for Clone 8 (Fig.4 A). The expression of GFP-FUS as detected using the anti-GFP immune reaction (Fig. 4 A, right panel) or the anti-FGFR1 immune reaction (not shown) correlated with the immune reaction with anti-phosphotyrosine (Fig. 4 A,left panel). These cells also demonstrated a close correlation of FUS expression with altered culture morphology. With increasing expression of GFP-FUS, the cells formed more tightly interacting cell clusters with reduced adherence to the tissue culture substratum (Fig. 4 C, left three panels). A similar change o