The CNC Basic Leucine Zipper Factor, Nrf1, Is Essential for Cell Survival in Response to Oxidative Stress-inducing Agents

Nrf1 is a member of the CNC-basic leucine zipper (CNC-bZIP) family of transcription factors. CNC bZIP factors, together with small Maf proteins, bind as heterodimers to the NF-E2/AP-1 element. Similarity between the NF-E2/AP-1 element and the antioxidant response element identified in a number of promoters of genes involved in detoxification and antioxidant response raises the possibility that Nrf1 plays a role in mediating the antioxidant response element response. In this study, we exploited the availability of cells from Nrf1 knockout mice to study the role of Nrf1 transcription factor in the regulation of antioxidant gene expression and in cellular antioxidant response. Fibroblast cells derived from Nrf1 null embryos showed lower levels of glutathione and enhanced sensitivity to the toxic effects of oxidant compounds. Our results indicate that Nrf1 plays a role in the regulation of genes involved in glutathione synthesis and suggest a basis for a correspondingly low GSH concentration and reduced stress response. Nrf1 is a member of the CNC-basic leucine zipper (CNC-bZIP) family of transcription factors. CNC bZIP factors, together with small Maf proteins, bind as heterodimers to the NF-E2/AP-1 element. Similarity between the NF-E2/AP-1 element and the antioxidant response element identified in a number of promoters of genes involved in detoxification and antioxidant response raises the possibility that Nrf1 plays a role in mediating the antioxidant response element response. In this study, we exploited the availability of cells from Nrf1 knockout mice to study the role of Nrf1 transcription factor in the regulation of antioxidant gene expression and in cellular antioxidant response. Fibroblast cells derived from Nrf1 null embryos showed lower levels of glutathione and enhanced sensitivity to the toxic effects of oxidant compounds. Our results indicate that Nrf1 plays a role in the regulation of genes involved in glutathione synthesis and suggest a basis for a correspondingly low GSH concentration and reduced stress response. reactive oxygen species antioxidant response element basic leucine zipper phosphate-buffered saline mouse embryonic fibroblast reverse-transcribed-polymerase chain reaction dithiothreitol base pair dichlorodihydrofluorescein diacetate γ-glutamylcysteine synthetase glutathione synthetase 3-(4,5 dimethythiazol-2-yl)-5-(3-carboxymethylphenyl)-2-(4-sulfophenyl)-2H Oxidants/reactive oxygen species (ROS)1 are by-products of normal metabolic reactions and environmental sources (1Halliwell B. Gutteridge J.M. Cross C.E. J. Lab. Clin. Med. 1992; 119: 598-620PubMed Google Scholar, 2Joshi M.S. Lancaster Jr., J.R. Dulbecco R. Encyclopedia of Human Biology. 4. Academic Press, San Diego1997: 107-114Google Scholar). A major source of ROS comes from cellular respiration when molecular oxygen is reduced to water in the mitochondria, from cellular metabolism of fatty acids, and from the respiratory burst pathway exploited by neutrophils and macrophages in the inflammatory response. Exogenous sources of ROS include chemical and physical agents such as UV radiation, environmental pollutants, and chemotherapeutic agents. ROS are short-lived and have diverse effects in the cell (1Halliwell B. Gutteridge J.M. Cross C.E. J. Lab. Clin. Med. 1992; 119: 598-620PubMed Google Scholar, 2Joshi M.S. Lancaster Jr., J.R. Dulbecco R. Encyclopedia of Human Biology. 4. Academic Press, San Diego1997: 107-114Google Scholar). On the one hand, they serve as key factors in the defense against bacterial infections, can stimulate cell proliferation, and serve as second messengers (3Irani K. Xia Y. Zweier J.L. Sollott S.J. Der C.J. Fearon E.R. Sundaresan M. Finkel T. Goldschmidt-Clermont P.J. Science. 1997; 275: 1649-1652Crossref PubMed Scopus (1418) Google Scholar). On the other hand, elevated levels of ROS are highly damaging as they react readily with many cellular components resulting in damage to DNA, lipids, and proteins. Because of these damaging effects, ROS have been implicated in a wide variety of disease states including cancer, neurodegenerative disease, ischemia-reperfusion injury, atherosclerosis, aging, and immune complex-mediated diseases (4Janssen Y.M. Van Houten B. Borm P.J. Mossman B.T. Lab. Invest. 1993; 69: 261-274PubMed Google Scholar, 5Knight J.A. Ann. Clin. Lab. Sci. 1998; 28: 331-346PubMed Google Scholar, 6Yu B.P. Physiol. Rev. 1994; 74: 139-162Crossref PubMed Scopus (2186) Google Scholar). Cells have evolved a battery of defense mechanisms to protect themselves against damage induced by ROS. Maintenance of intracellular redox balance and metabolism of exogenous toxins are mediated in part by thiol-rich molecules such as glutathione and metallothioneins, and detoxifying enzymes such as NAD(P)H:quinone oxidoreductases, glutathione S-transferases, glutathione peroxidases, heme oxygenase, and UDP-glucuronosyltransferases. Essential to constitutive and induced expression of a number of genes that participate in the protection against oxidative stress is the antioxidant response element (ARE) (7Jaiswal A.K. Biochem. Pharmacol. 1994; 48: 439-444Crossref PubMed Scopus (223) Google Scholar). The ARE, also referred to as the electrophile response element, is found in the promoters of a number of these genes (8Favreau L.V. Pickett C.B. J. Biol. Chem. 1993; 268: 19875-19881Abstract Full Text PDF PubMed Google Scholar, 9Favreau L.V. Pickett C.B. J. Biol. Chem. 1995; 270: 24468-24474Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 10Li Y. Jaiswal A.K. Eur. J. Biochem. 1994; 226: 31-39Crossref PubMed Scopus (72) Google Scholar, 11Prestera T. Talalay P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8965-8969Crossref PubMed Scopus (218) Google Scholar). The ARE has been shown to bind a number of different transcription factors including basic leucine zipper proteins, AP-1, and other novel factors whose identities have yet to be identified (7Jaiswal A.K. Biochem. Pharmacol. 1994; 48: 439-444Crossref PubMed Scopus (223) Google Scholar, 12Wasserman W.W. Fahl W.E. Arch. Biochem. Biophys. 1997; 344: 387-396Crossref PubMed Scopus (54) Google Scholar). Basic leucine zipper (bZIP) transcription factors play important roles in growth and differentiation. There are several distinct subgroups of bZIP proteins, namely the AP-1, ATF/CREB, Maf, and CNC-basic leucine zipper families (13Blank V. Andrews N.C. Trends Biochem. Sci. 1997; 22: 437-441Abstract Full Text PDF PubMed Scopus (217) Google Scholar, 14Chan J.Y. Cheung M.C. Moi P. Chan K. Kan Y.W. Hum. Genet. 1995; 95: 265-269Crossref PubMed Scopus (58) Google Scholar, 15Pabo C.O. Sauer R.T. Annu. Rev. Biochem. 1992; 61: 1053-1095Crossref PubMed Scopus (1218) Google Scholar). The CNC-basic leucine zipper (CNC-bZIP) family was identified from independent searches for factors that bind the tandem NF-E2/AP-1 like cis-elements in the β-globin locus control region. Members in this family include p45-NF-E2, Nrf1 (LCRF1, TCF11), Nrf2, ECH, Bach1, and -2 (16Andrews N.C. Erdjument B.H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (564) Google Scholar, 17Caterina J.J. Donze D. Sun C.W. Ciavatta D.J. Townes T.M. Nucleic Acids Res. 1994; 22: 2383-2391Crossref PubMed Scopus (123) Google Scholar, 18Chan J.Y. Han X.L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11371-11375Crossref PubMed Scopus (292) Google Scholar, 19Chan J.Y. Han X.L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11366-11370Crossref PubMed Scopus (109) Google Scholar, 20Itoh K. Igarashi K. Hayashi N. Nishizawa M. Yamamoto M. Mol. Cell. Biol. 1995; 15: 4184-4193Crossref PubMed Scopus (353) Google Scholar, 21Luna L. Johnsen O. Skartlien A.H. Pedeutour F. Turc-Carel C. Prydz H. Kolsto A.B. Genomics. 1994; 22: 553-562Crossref PubMed Scopus (84) Google Scholar, 22Moi P. Chan K. Asunis I. Cao A. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9926-9930Crossref PubMed Scopus (1165) Google Scholar, 23Ney P.A. Andrews N.C. Jane S.M. Safer B. Purucker M.E. Weremowicz S. Morton C.C. Goff S.C. Orkin S.H. Nienhuis A.W. Mol. Cell. Biol. 1993; 13: 5604-5612Crossref PubMed Scopus (162) Google Scholar). Although homologies among the different bZIP proteins are apparent in the basic and leucine zipper regions, the similarity between CNC-bZIP proteins is most remarkable in the basic-DNA binding region, suggesting that they bind the NFE2/AP-1-like recognition site with similar affinities (14Chan J.Y. Cheung M.C. Moi P. Chan K. Kan Y.W. Hum. Genet. 1995; 95: 265-269Crossref PubMed Scopus (58) Google Scholar). In addition, a stretch spanning 43 amino acids immediately N-terminal to the basic domain is highly conserved especially between Nrf1, Nrf2, and p45NF-E2. This region is also highly conserved in theDrosophila CNC protein and in the Caenorhabditis elegans Skn protein, but it is not present in Jun, Fos, or other bZIP proteins. This region has been referred to as the “CNC” domain. Whereas CNC-bZIP proteins have been shown to dimerize with the small Maf family of bZIP proteins, it is not known whether they indeed function as obligate heterodimers in vivo (13Blank V. Andrews N.C. Trends Biochem. Sci. 1997; 22: 437-441Abstract Full Text PDF PubMed Scopus (217) Google Scholar, 24Johnsen O. Murphy P. Prydz H. Kolsto A.B. Nucleic Acids Res. 1998; 26: 512-520Crossref PubMed Scopus (90) Google Scholar, 25Marini M.G. Chan K. Casula L. Kan Y.W. Cao A. Moi P. J. Biol. Chem. 1997; 272: 16490-16497Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 26Motohashi H. Shavit J. Igarashi K. Yamamoto M. Engel J. EMBO J. 1997; 25: 2953-2959Google Scholar, 27Toki T. Itoh J. Kitazawa J. Arai K. Hatakeyama K. Akasaka J. Igarashi K. Nomura N. Yokoyama M. Yamamoto M. Ito E. Oncogene. 1997; 14: 1901-1910Crossref PubMed Scopus (94) Google Scholar). The human NRF1 gene was isolated as a result of our efforts to clone cDNAs, using a yeast expression system, that encode proteins that bind the tandem NFE2/AP-1 like cis-elements in the β-globin locus control region (18Chan J.Y. Han X.L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11371-11375Crossref PubMed Scopus (292) Google Scholar). Nrf1 is widely expressed with high levels of the transcript found in liver, lung, heart, muscle, and kidney. To determine its physiologic role, we have used gene targeting in embryonic stem cells to generate mice with disruption in thenrf1 gene (28Chan J.Y. Kwong M. Hua R.H. Chang J. Yen T.S.B. Kan Y.W. EMBO J. 1998; 17: 1779-1787Crossref PubMed Scopus (214) Google Scholar). nrf1 is an essential gene as homozygous disruption of it results in death in utero (28Chan J.Y. Kwong M. Hua R.H. Chang J. Yen T.S.B. Kan Y.W. EMBO J. 1998; 17: 1779-1787Crossref PubMed Scopus (214) Google Scholar,29Farmer S.C. Sun C.W. Winnier G.E. Hogan B.L. Townes T.M. Genes Dev. 1997; 11: 786-798Crossref PubMed Scopus (98) Google Scholar). Homozygous mutant embryos have decreased definitive enucleated red cells, and as a result, these mice suffer from anemia and die in utero (28Chan J.Y. Kwong M. Hua R.H. Chang J. Yen T.S.B. Kan Y.W. EMBO J. 1998; 17: 1779-1787Crossref PubMed Scopus (214) Google Scholar). The red cell defect, however, does not appear to be cell-autonomous as Nrf1−/− embryonic stem cells contribute efficiently to blood formation in chimeric animals (28Chan J.Y. Kwong M. Hua R.H. Chang J. Yen T.S.B. Kan Y.W. EMBO J. 1998; 17: 1779-1787Crossref PubMed Scopus (214) Google Scholar). Whether Nrf1 regulates the expression of cytokine and/or other extracellular factors that play a role in erythroid maturation or red cell survival remains to be determined. The NF-E2/AP-1 element, also referred to as the Maf recognition element, has been shown to be similar to the antioxidant response element (ARE) (30Venugopal R. Jaiswal A.K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14905-14960Crossref Scopus (914) Google Scholar). Based on the similarity of the NFE2/AP1 and the ARE sequence, one potential role of CNC-bZIP proteins is in the regulation of antioxidant expression. Whereas regulation of basal and induced expression of antioxidant genes are mediated in part by the ARE sequence, the identity of the ARE-binding protein(s) remains unclear. Members of the CNC-bZIP family and small Maf family of proteins have been implicated recently in mediating ARE function. By transfection experiments, Nrf1 and Nrf2 have been shown to up-regulate the human NQO1 gene promoter in HepG2 liver cells (30Venugopal R. Jaiswal A.K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14905-14960Crossref Scopus (914) Google Scholar). Whereas Nrf2 knockout mice are viable (31Chan K. Lu R. Chang J.C. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13943-13948Crossref PubMed Scopus (504) Google Scholar, 32Itoh K. Chiba T. Takahashi S. Ishii T. Igarashi K. Katoh Y. Oyake T. Hayashi N. Satoh K. Hatayama I. Yamamoto M. Nabeshima Y. Biochem. Biophys. Res. Commun. 1997; 236: 313-322Crossref PubMed Scopus (3088) Google Scholar, 33Martin F. van Deursen J.M. Shivdasani R.A. Jackson C.W. Troutman A.G. Ney P.A. Blood. 1998; 91: 3459-3466Crossref PubMed Google Scholar), they were found to be impaired in the induction of glutathione S-transferase and human NQO1 gene expression (32Itoh K. Chiba T. Takahashi S. Ishii T. Igarashi K. Katoh Y. Oyake T. Hayashi N. Satoh K. Hatayama I. Yamamoto M. Nabeshima Y. Biochem. Biophys. Res. Commun. 1997; 236: 313-322Crossref PubMed Scopus (3088) Google Scholar). Thus, the Nrf2 knockout data provide further genetic evidence for a role of CNC-bZIP proteins in the regulation of ARE-controlled genes. As Nrf1 and Nrf2 share striking similarities in their DNA-binding domains as well as in their expression patterns, we hypothesize that Nrf1 also plays a role in the regulation of antioxidant gene expression. In this study, we examined this proposed function using mouse fibroblasts derived from Nrf1 mutant embryos. We found that Nrf1−/− fibroblasts have decreased glutathione levels and are hypersensitive to the toxic effects of oxidants. Glutamylcysteine-light chain synthetase and glutathione synthetase, genes in the GSH biosynthetic pathway, are down-regulated in Nrf1-deficient fibroblasts. The identification of glutamylcysteine light chain synthetase and glutathione synthetase as downstream targets provides important clues to the role of Nrf1 in cellular function and potential relevance to disease states. Isolation of mouse fibroblast from embryos was done using standard protocols (34Hogan B. Beddington R. Constantini F. Lacy E. Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994Google Scholar). Mutant embryos were derived from matings of Nrf1+/− mice described previously (28Chan J.Y. Kwong M. Hua R.H. Chang J. Yen T.S.B. Kan Y.W. EMBO J. 1998; 17: 1779-1787Crossref PubMed Scopus (214) Google Scholar) and from another knockout line bearing the β-galactosidase gene targeted into the nrf1 locus to be described elsewhere. Cytotoxic effects of various compounds were determined by either trypan blue dye exclusion or using a microtiter assay for cell survival. For cell survival determination, approximately 1–5 × 104mouse embryonic fibroblast (MEF) cells were plated in 96-well dishes in Dulbecco's modified Eagle's medium with 15% fetal calf serum. After overnight incubation, cells were then treated for 8–12 h with paraquat, diamide, or cadmium chloride. Following treatment, cells were washed twice with 1× PBS and then cultured in Dulbecco's modified Eagle's medium with 15% fetal calf serum for 1–2 days. The number of remaining cells was quantified by measuring the formation of formazan from MTS-tetrazolium (Promega) using a multiplate reader set at 490 nm wavelength. For direct quantitation of cell death, approximately 1–2 × 105 cells were plated on 24-well culture dishes and were treated as described. Following treatment, viable cells were counted by trypan blue exclusion. Cell morphology after drug treatment was examined by Diff-quick staining (Dade Diagnostics) of cells grown on chamber slides. Terminal deoxynucleotidyltransferase-mediated dUTP nick-end labeling assays were done using ApoAlert Kits from CLONTECH. Briefly, 5 × 104 MEF cells were grown on chamber slides and were treated with various compounds as outlined above. After treatment, cells were washed twice with 1× PBS, fixed with 4% paraformaldehyde, 1× PBS solution, and permeabilized with 0.2% Triton-X/PBS solution. Fragmented DNA in apoptotic cells was labeled at their 3′-hydroxyl ends with fluorescein-conjugated dUTP using terminal deoxynucleotidyltransferase. Labeling was performed in the dark for 60 min. The reaction was quenched in 2× SSC, and the cells were washed twice with 1× PBS. Cells were then mounted in Antifade (Sigma) with propidium iodide on glass slides. Labeled DNA in cells was then visualized by fluorescent microscopy. Approximately 1 × 106 MEF cells were trypsinized to generate single cell suspension and preloaded with 10 μm 2′,7′-dichlorodihydrofluorescein diacetate (DCFHDA) for 30 min in 1× PBS with 2% fetal calf serum. DCFHDA-loaded cells were then treated with 60 mm paraquat. After 4 h of incubation, propidium iodide was added to a final concentration of 1 μg/ml prior to analysis by flow cytometry. The oxidative conversion of DCFHDA to its fluorescent analog was assessed by the amount of fluorescent signal in live cells by flow cytometry. Detection of intracellular glutathione levels was done using GSH assay kit from Oxis International or according to the method described by Griffith (35Griffith O.W. Anal. Biochem. 1980; 106: 207-212Crossref PubMed Scopus (3954) Google Scholar) from supernatants of approximately 1–2 × 107 cells. A fragment of 834 base pairs corresponding to −1096 to −253 nucleotides (36Moinova H.R. Mulcahy R.T. J. Biol. Chem. 1998; 273: 14683-14689Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar) of the human GCS light chain synthetase gene promoter was amplified using Pfu polymerase and then cloned into pCRBlunt (Invitrogen). The promoter fragment was then directionally cloned into the KpnI and XhoI sites of pGL3Basic (Promega) resulting in pGCSLpLuc plasmid. Nrf1 expression plasmid was constructed by cloning a 2.2-kilobase pair KpnI/XbaI fragment containing the human NRF1 cDNA into pEF1a-V5 vector (Invitrogen). Mouse embryonic fibroblast cells were plated at 50% confluency a day prior to transfection. For cotransfections, equal amounts of the luciferase reporter plasmid and pEF1a-Nrf1 expression plasmid were transfected by LipofectAMINE (Life Technologies, Inc.) according to manufacturer's protocol. Following transfections, cells were incubated at 37 °C for 48–72 h prior to harvest for luciferase assays. Lysates were prepared according to manufacturer's protocol and assayed for luciferase activity using the Dual Reporter system (Promega). Activity obtained from each sample was normalized for transfection efficiency by measuring Renilla luciferase activity derived from the pRL-TK plasmid included as internal control in the transfection and protein concentration by the Bradford method (Bio-Rad). RNA extractions were carried out using Ultraspec RNA extraction solution (Biotecx). For reverse-transcribed-polymerase chain reaction (RT-PCR), first-strand cDNA was synthesized using random hexamer primers according to manufacturer's protocol (Amersham Pharmacia Biotech). PCR were carried out in 10 mm Tris-HCl, pH 8.3, 50 mm KCl, 1.5 mm MgCl2, 0.2 mm dNTP, 0.1 μCi of [α-32P]dCTP (3000 Ci/mm; Amersham Pharmacia Biotech), 10 pmol of each of the primers, and 2.5 units of AmpliTaq polymerase (Perkin-Elmer). PCR primer sequences are as follows: actin, 5′-ATCTGGCACCACACCTTCTACAATGAGCTGCG and 3′CGTCATACTCCTGCTTGCTGATCCACATCTGC; ARPO (acidic ribosomal protein P0), 5′-AGCTCTGAGAAACTGCTGCCTCA and 3′-CAGTCTCCACAGACAATGCCAGGA; GSS, 5′-AATGCGGTGGTGCTACTGATTGCT and 3′GATACACTGGACCACTTGGGCAGG; GCSL, 5′-ATGTTTTGGAATGCCACATGTCCC and 3′-GATACACTGGACCACTTGGGCAGG; GCSH, 5′-ACAAGCACCCCCGCTTCGGTACTC and 3′-CTCCAGGCCTCTCTCCTCCCGTGT. Aliquots of PCR reactions were sampled after various cycle numbers (empirically determined to maintain linear amplification range) and electrophoresed through 5% polyacrylamide gel. Band intensities were quantitated by phosphorimaging and were limited to samples in which amplifications were within the linear range. Quantitations were similar regardless whether ARPO or β-actin were used as internal controls. Control experiments in which reverse transcriptase was left out of the cDNA synthesis reaction step failed to show specific PCR products. In vitro transcription and translation of Nrf1 and human MAF (25Marini M.G. Chan K. Casula L. Kan Y.W. Cao A. Moi P. J. Biol. Chem. 1997; 272: 16490-16497Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar) were done using TnT reticulocyte lysate system from Promega as described previously (28Chan J.Y. Kwong M. Hua R.H. Chang J. Yen T.S.B. Kan Y.W. EMBO J. 1998; 17: 1779-1787Crossref PubMed Scopus (214) Google Scholar). Binding reactions were carried out in a mixture containing extracts,32P-labeled double-stranded oligonucleotide probes corresponding to the antioxidant response element of human GCSL gene promoter (36Moinova H.R. Mulcahy R.T. J. Biol. Chem. 1998; 273: 14683-14689Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar) (wild type-CTACGATTTCTGCTTAGTCATTGTCTTCC; mutant-CTACGATTTCTGCTTAGTCcTTGTCTTCC), 20 mm Hepes-KOH, pH 7.9, 1 mm EDTA, 20 mm KCl, 5 mm DTT, 4 mmMgCl2, 1 μg poly(dI-dC), 4% glycerol. Mixtures were incubated at 37 °C for 20 min, and the DNA-protein complexes were resolved on nondenaturing 4% acrylamide gels. For supershift experiments, antibodies were incubated with the extracts for 10 min at 37 °C prior to addition of ARE probe to the binding reaction mix. Antibodies to Nrf1, Nrf2, p45-NF-E2, and p18-NF-E2 were purchased from Santa Cruz Biotechnology. Cell extracts from mouse Hepa1–6 cells were prepared using the protocol described by Jackson (37Jackson S.P. Hames B.D. Higgins S.J. Gene Transcription. 117. IRL Press at Oxford University Press, New York1993: 189-242Google Scholar). Briefly, cells were washed twice with 1× PBS prior to harvest by scraping. Cells were pelleted by a brief centrifugation and lysed by Dounce homogenization in a hypotonic buffer (10 mm Hepes-KOH, pH 7.6, 10 mm KCl, 1.5 mm MgCl2, 1 mm DTT, 0.5 mm phenylmethylsulfonyl fluoride). Nuclei were collected by centrifugation, followed by extraction in a high salt buffer (20 mm Hepes-KOH, pH 7.6, 0.42 m NaCl, 1.5 mm MgCl2, 0.2 mm EDTA, 1 mm DTT, 1 mm phenylmethylsulfonyl fluoride, 6.25% glycerol). The cytoplasmic fraction was adjusted with 10% volume of buffer containing 300 mm Hepes-KOH, pH 7.6, 1.4m KCl, 30 mm MgCl2, 1 mm DTT, 1 mm phenylmethylsulfonyl fluoride. The survival of MEF in different concentrations of oxidants was tested to examine whether a deficiency in Nrf1 would result in increased sensitivity of cells to oxidative stress. Fibroblast cells derived from wild type and Nrf1 null embryos were cultured in the redox cycling herbicide paraquat. A dose-dependent loss of cell viability was seen in both wild type and Nrf1−/− cells examined. However, wild type MEF cells were less sensitive to the toxic effects of paraquat compared with Nrf1−/− cells (Fig. 1 A). The concentration of paraquat required for 50% killing of +/+ and −/− cells were 0.6 and 0.2 mm, respectively. We also observed a considerable alteration in morphology of Nrf1−/− cells exposed to paraquat. Whereas wild type cells remained flat and adherent, mutant cells showed rounding and numerous cell-surface blebbings (data not shown) in addition to increased cell death (Fig. 2 A). To determine whether the cells are undergoing apoptosis, terminal transferase assays to detect nuclear DNA fragmentation were done. The number of fluorescent labeled cells before and after paraquat treatment was not appreciably increased in wild type MEF cells (Fig. 2 A). In contrast, the percentage of labeled cells increased considerably in paraquat-treated Nrf1−/− MEF cells. Labeled cells were detected at even 0.6 mm concentration of paraquat tested. Nrf1 null cells were also tested with other oxidant compounds to determine whether enhanced toxicity was restricted only to paraquat. An increased sensitivity was also seen when Nrf1 null cells were treated with cadmium chloride (Fig. 1 B), and the decrease in viability was very pronounced with diamide treatment (Fig. 2 B). These results demonstrate that Nrf1 null cells are more susceptible to various compounds known to cause oxidative stress and that cell death appears to occur via apoptosis.FIG. 2Morphology and terminal deoxynucleotidyltransferase labeling of Nrf1+/+ and Nrf1−/− fibroblasts treated with paraquat (A) and diamide (B). Left panels show Nrf1+/+ cells and right panelsshow Nrf1−/− cells. Mutant cells show increase in cell death and a higher proportion terminal deoxynucleotidyltransferase labeling after paraquat treatment. Note the dramatic effect of diamide on the viability of Nrf1−/− fibroblasts.View Large Image Figure ViewerDownload (PPT) Because cytotoxicity of paraquat is known to be associated with redox cycling and superoxide generation (38Krall J. Bagley A.C. Mullenbach G.T. Hallewell R.A. Lynch R.E. J. Biol. Chem. 1988; 263: 1910-1914Abstract Full Text PDF PubMed Google Scholar), it seemed reasonable to determine whether Nrf1−/− MEF cells accumulate higher levels of free radicals. To test this idea, intracellular oxidation of the reporter DCFHDA fluorescent dye was measured by flow cytometry. Basal levels of fluorescent DCFHDA formation in Nrf1−/− MEF cells were similar to that seen in wild type control cells (Fig. 3). This suggests that Nrf1−/− MEF cells were not under increased free radical burden compared with wild type cells under normal conditions. With paraquat treatment, there was approximately a 3–4-fold increase in fluorescence detected in Nrf1−/−MEF cells. In contrast, no increase in fluorescence was detected in wild type control cells. This result indicates that wild type cells were able to cope with the increased intracellular oxidative burden as a result of superoxide generation from paraquat treatment, whereas Nrf1−/− MEF cells were diminished in this capacity. Glutathione (GSH) is a major redox molecule found at high concentrations in all cells. GSH has numerous functions, an important one is to protect cells against ROS by means of its nucleophilic and reducing capacity. A decrease in GSH levels could result in a diminished reserve in intracellular reducing capacity resulting in an enhanced sensitivity to oxidants. Indeed, it has been shown that drug-induced GSH depletion in mice results in enhanced paraquat toxicity (39Nakagawa I. Suzuki M. Imura N. Naganuma A. J. Toxicol. Sci. 1995; 20: 557-564Crossref PubMed Scopus (19) Google Scholar). To test whether Nrf1 deficiency has an effect on glutathione levels, GSH contents of wild type and Nrf1−/− cells were measured. GSH levels of Nrf1−/− cells were approximately half of control wild type cells (Table I), whereas oxidized GSH (GSSG) levels were not found to be different between control wild type cells and Nrf1−/− cells (data not shown). These findings imply that lowered GSH levels in Nrf1−/− cells were not from increased GSSG formation as a result of GSH oxidation under conditions of oxidative stress. One possibility for lowered GSH levels is that the synthesis of GSH is diminished in Nrf1−/− cells.Table IDecreased glutathione levels in Nrf1 −/− fibroblastsGSH levelsExp. 1Exp. 2Exp. 3Exp. 4μmol/mg proteinWild type0.0780.0450.0650.057Nrf1−/−0.051 (65%)0.026 (58%)0.038 (58%)0.029 (51%) Open table in a new tab The formation of GSH occurs by a two-step process catalyzed by the sequential action of γ-glutamylcysteine synthetase (GCS) and glutathione synthetase (GSS). The GCS holoenzyme is composed of two subunits as follows: a light chain, designated GCSL, bears a regulatory function, and a heavy chain, designated GCSH, is responsible for the catalytic function. As antioxidant response elements have been described in the promoter regions of both the humanGCS heavy and light chain genes, we examined the expression of these genes in wild type and Nrf1−/− fibroblasts. By RT-PCR analysis, the gcs light chain gene transcript showed a 3–4-fold reduction in Nrf1−/− fibroblasts compared with wild type fibroblasts (Fig. 4 A). Similar results were obtained by Northern blot analysis (Fig. 4 B). In contrast, no significant difference in expression of the heavy chaingcs gene was detected between wild type and Nrf1−/− fibroblasts (Fig. 4, A andB). As expression of human GCS H andGCS L genes has been shown to be inducible after treatment with oxidants such as β-naphthoflavone (36Moinova H.R. Mulcahy R.T. J. Biol. Chem. 1998; 273: 14683-14689Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 40Mulcahy R.T. Wartman M.A. Bailey H.H. Gipp J.J. J. Biol. Chem. 1997; 272: 7445-7454Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar), we next determined whether induced levels of these genes are also affected in Nrf1 mutant fibroblasts. Although exposure of MEF cells to paraquat resulted in an increase of gcs L gene transcript levels, expression levels were reduced in Nrf1−/−fibroblasts compared with wild type cells treated with paraquat (Fig. 4, A and B). Thus, the absence of Nrf1 did not abolish induction of gcs L gene expression. Levels ofgss gene transcript were also examined and were found to be down-regulated approximately 3-fold in Nrf1−/− cells (Fig. 4 A). Induction of GSH synthetase gene expression was blunted but not abolished in Nrf1−/− cells treated with paraquat (data not shown). Whether