First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China

HomePlant DiseaseVol. 105, No. 10First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China PreviousNext DISEASE NOTE OPENOpen Access licenseFirst Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, ChinaJinjie Hu, Qian Zhou, Chaohui Shi, Shun Xiao, Yexin Ke, and Guokun LiuJinjie HuKey Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002, Fuzhou, Fujian, P.R. ChinaSearch for more papers by this author, Qian ZhouKey Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002, Fuzhou, Fujian, P.R. ChinaSearch for more papers by this author, Chaohui ShiKey Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002, Fuzhou, Fujian, P.R. ChinaSearch for more papers by this author, Shun XiaoKey Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002, Fuzhou, Fujian, P.R. ChinaSearch for more papers by this author, Yexin KeKey Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002, Fuzhou, Fujian, P.R. ChinaSearch for more papers by this author, and Guokun Liu†Corresponding author: G. K. Liu; E-mail Address: liuguok@126.comhttps://orcid.org/0000-0002-0441-269XKey Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002, Fuzhou, Fujian, P.R. ChinaSearch for more papers by this author AffiliationsAuthors and Affiliations Jinjie Hu Qian Zhou Chaohui Shi Shun Xiao Yexin Ke Guokun Liu † Key Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002, Fuzhou, Fujian, P.R. China Published Online:22 Oct 2021https://doi.org/10.1094/PDIS-01-21-0139-PDNAboutSectionsView articlePDFSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleEggplant (Solanum melongena L.) is one of the most popular vegetables in China. In July 2019, a serious stem canker disease of eggplant (cv. Hangqieyihao) was found in commercial fields in Pingnan County (26°47′35.16″N, 118°56′31.6″E), Fujian Province. The disease incidence ranged from 38 to 72%. At first, the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing numerous tiny black dots. When stem girdling occurs, the shoot above the infected area wilts and dries up, and it is the reason for the yield loss. The teleomorph of the fungus has not been encountered in symptomatic stems. An isolate was obtained from a diseased branch by using routine fungal isolation methods and single-spore purification technique, which was designated as FAFU01. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12-h/12-h cycles of light and darkness until sporulation. The fungus initially produced white fluffy aerial hyphae, forming a relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidia had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 μm long, and 1.0 to 2.5 μm wide. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 μm long, and 1.5 to 3.2 μm wide. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, 17.0 to 26.9 μm long, and 0.86 to 1.23 μm wide. Based on these morphological characters, the fungus was preliminarily identified as Phomopsis longicolla (Hobbs et al. 1985). The internal transcribed spacer region of the ribosomal DNA of the isolate FAFU01 was amplified with primers ITS1/ITS4 (TCCGTAGGTGAACCTGCGG/TCCTCCGCTTATTGATATGC) (White et al. 1990) and a 578-bp sequence obtained (GenBank accession no. MW380387) was 96 to 98.3% identical to the known sequence of P. longicolla (syn. Diaporthe longicolla) in GenBank. For further confirmation, P. longicolla-specific primers Phom.I/Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al. 1997) were used, and a 337-bp amplification product was obtained, which was previously reported only for P. longicolla, whereas no product was amplified from the negative control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests at 25 to 28°C, 35-day-old plants of eggplant (cv. Hangqieyihao) were each maintained in a 30-cm-diameter pot. The healthy stem on the plants was wounded by pinpricking (Wei et al. 2019). Both wounded and nonwounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for 2 days. Four days after inoculation, the plugs were washed from the stems with sterile water. Thirty-five days after inoculation, canker lesions and small black pycnidia, which were similar to those in the field, were observed on the surface of nonwounded and wounded asymptomatic stems inoculated with the pathogen, whereas all the control stems remained healthy. The fungus was reisolated from the infected stems of plants and was further confirmed with the species-specific primers, fulfilling Koch’s postulates. This is the first report of P. longicolla causing stem canker on eggplant in Fujian Province, China.The author(s) declare no conflict of interest.References:Hobbs, T. W., et al. 1985. Mycologia 77:535. https://doi.org/10.1080/00275514.1985.12025139 Crossref, ISI, Google ScholarWei, X. Y., et al. 2019. Plant Dis. 103:143. https://doi.org/10.1094/PDIS-03-18-0397-PDN Link, ISI, Google ScholarWhite, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. Google ScholarZhang, A. W., et al. 1997. Plant Dis. 81:1143. https://doi.org/10.1094/PDIS.1997.81.10.1143 Link, ISI, Google ScholarThe author(s) declare no conflict of interest.Funding: Funding was provided by the National Key Research and Development Program of China (2018YFD0201200).DetailsFiguresLiterature CitedRelated Vol. 105, No. 10 October 2021SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionPycnidia of Leptosphaeria biglobosa formed on a necrotic tissue of a blighted leaf petiole of Brassica rapa subsp. pekinensis (C. Yu et al.). Photo credit: C. Yu. Panicle blast of rice from a site in sub-Saharan Africa (S. K. Mutiga et al.). Photo credit: V. Were. Symptoms of bud soft rot on agave caused by Pantoea dispersa (F. Palemón-Alberto et al.). Photo credit: S. Ortega-Acosta. Metrics Article History Issue Date: 28 Dec 2021Published: 22 Oct 2021First Look: 4 May 2021Accepted: 14 Apr 2021 Page: 3296 Information© 2021 The American Phytopathological SocietyFundingNational Key Research and Development Program of ChinaGrant/Award Number: 2018YFD0201200KeywordsDiaporthe longicollamorphologymolecularrDNA-ITSpathogenicityThe author(s) declare no conflict of interest.PDF downloadCited ByDiaporthe Diversity and Pathogenicity Revealed from a Broad Survey of Soybean Stem Blight in ChinaXiaolin Zhao, Kainan Li, Sujiao Zheng, Jin Yang, Changjun Chen, Xiaobo Zheng, Yuanchao Wang, and Wenwu Ye12 October 2022 | Plant Disease, Vol. 0, No. 0